ORFeome > taf8 ORF1 – XORFeome v1.0

taf8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: taf8
Gene ID: 6253923
Gene Page ID: 491355
ORF Xenbase ID: 17299911

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043877
Original XGC clone length: 882

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ823877
dbEST ID: 79641579
Trimmed Sequence: ATGTTTCCTACAATTAGATCTTGTGCACGTGGGACTTCCACCCCTGCCGATAATTACATGTTGGCAAGACGCAGGACACTGCAGGTGGTGGTCAGTTCTCTGCTTACAGAAGCTGGATTTGATAGTGCAGAGAAAGCAGCTGTAGAAAGTTTAACTGAAATGCTACAGAGCTATCTGTCAGAGATTGGACGAAGTGCAAAGTCATACTGTGAACACACTGCACGGACACAGCCCACATTGCCAGACATTGTGGTGACTCTGATAGAAATGGGGTTTAATGTAGACAGTTTGCCTGCCTATGCCAAGCGGTCCCAGCGGATGGTGATAACAGCACCTCCTGTAACAAACAATCCTGTGGTTCCTAAAGCTCTGAGTGCAGGAGATAACAAGCCACACCCTGCTCACATTCCAAGTCATTTTCCAGAGTTTCCAGATCCTCATACCTACATTAAAACACCGACTTATCGTGAACCAGTGTGTGATTACCAGGTCTTGCGTGAGAAGGCAGCATCACAGCGTAGAGATGTGGAAAGGGCCCTCACTCGATTTATGGCTAATACAGGCGAGACACAGAGCTTGTTCAAAGATGACACAAGCACTTTTCCATTGATTGCAGCGCGTCCACTCTCAATACCTTATCTGAATGCCCTCCTACCATCAGAACTGGAACTGCAGCANGTAGATGAGACTGATTCCTCGGAGCAGGAGATCAGACGAACCCGAAAAACTTTCTCTGCTCCTCAGGGGGATGAATTGGGGGGGGGGGGAAAAAAAAAAGCCTCTCTTTTTATACCAAAATTCTTTTAAAGGGGGGGGGAGAGAAAAAAACTTTTA
Full Trace Sequence: CAAATATGATTTCAATTTTGACTGAAAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTCCTACAATTAGATCTTGTGCACGTGGGACTTCCACCCCTGCCGATAATTACATGTTGGCAAGACGCAGGACACTGCAGGTGGTGGTCAGTTCTCTGCTTACAGAAGCTGGATTTGATAGTGCAGAGAAAGCAGCTGTAGAAAGTTTAACTGAAATGCTACAGAGCTATCTGTCAGAGATTGGACGAAGTGCAAAGTCATACTGTGAACACACTGCACGGACACAGCCCACATTGCCAGACATTGTGGTGACTCTGATAGAAATGGGGTTTAATGTAGACAGTTTGCCTGCCTATGCCAAGCGGTCCCAGCGGATGGTGATAACAGCACCTCCTGTAACAAACAATCCTGTGGTTCCTAAAGCTCTGAGTGCAGGAGATAACAAGCCACACCCTGCTCACATTCCAAGTCATTTTCCAGAGTTTCCAGATCCTCATACCTACATTAAAACACCGACTTATCGTGAACCAGTGTGTGATTACCAGGTCTTGCGTGAGAAGGCAGCATCACAGCGTAGAGATGTGGAAAGGGCCCTCACTCGATTTATGGCTAATACAGGCGAGACACAGAGCTTGTTCAAAGATGACACAAGCACTTTTCCATTGATTGCAGCGCGTCCACTCTCAATACCTTATCTGAATGCCCTCCTACCATCAGAACTGGAACTGCAGCANGTAGATGAGACTGATTCCTCGGAGCAGGAGATCAGACGAACCCGAAAAACTTTCTCTGCTCCTCAGGGGGATGAATTGGGGGGGGGGGGAAAAAAAAAAGCCTCTCTTTTTATACCAAAATTCTTTTAAAGGGGGGGGGAGAGAAAAAAACTTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTCCTACAATTAGATCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829183
dbEST ID: 79646885
Trimmed Sequence: TTTCTTACGCCTTAATTTAGGTTTTTTCACGGGTCGCAGATAGGGATTATCTATAAGTGTTTCCTCTCCACCCTTCATTGAATTCTGCTGTAATACAGATGCATTTTCTTTCTCCATCCCCACTTCATCCCCTTGCAGATGCAGAGACAGATTCTCTGTGTCCGTCTGATCATCTTGCTCCGAGGAATCAGTCTCATCTACCTGCTGCAGTTCCAGTTCTGATGGTAGGAGGGCATTCAGATAAGGTATTGAGAGTGGACGCGCTGCAATCAATGGAAAAGTGCTTGTGTCATCTTTGAACAAGCTCTGTGTCTCGCCTGTTTTAGCCATAAATCGAGTGAGGGCCCTTTCCACATCTCTACGCTGTGATGCTGCCTTCTCACGCAAGACCTGGTAATCACACACTGGTTCACGATAAGTCGGTGTTTTAATGTAGGTATGAGGATCTGGAAACTCTGGAAAATGACTTGGAATGTGAGCAGGGTGTGGCTTGTTATCTCCTGCACTCAGAGCTTTAGGAACCACAGGATTGTTTGTTACAGGAGGTGCTGTTATCACCATCCGCTGGGACCGCTTGGCATAAGCAGGCAAACTGTTTACATTAAAACCCATTTCTATCAGAGTCACCCCAATGTCGGGCATGGTGGGCTGGGGTCCGTGCAATGGTGTTCAAAGT
Full Trace Sequence: CTGACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTACGCCTTAATTTAGGTTTTTTCACGGGTCGCAGATAGGGATTATCTATAAGTGTTTCCTCTCCACCCTTCATTGAATTCTGCTGTAATACAGATGCATTTTCTTTCTCCATCCCCACTTCATCCCCTTGCAGATGCAGAGACAGATTCTCTGTGTCCGTCTGATCATCTTGCTCCGAGGAATCAGTCTCATCTACCTGCTGCAGTTCCAGTTCTGATGGTAGGAGGGCATTCAGATAAGGTATTGAGAGTGGACGCGCTGCAATCAATGGAAAAGTGCTTGTGTCATCTTTGAACAAGCTCTGTGTCTCGCCTGTTTTAGCCATAAATCGAGTGAGGGCCCTTTCCACATCTCTACGCTGTGATGCTGCCTTCTCACGCAAGACCTGGTAATCACACACTGGTTCACGATAAGTCGGTGTTTTAATGTAGGTATGAGGATCTGGAAACTCTGGAAAATGACTTGGAATGTGAGCAGGGTGTGGCTTGTTATCTCCTGCACTCAGAGCTTTAGGAACCACAGGATTGTTTGTTACAGGAGGTGCTGTTATCACCATCCGCTGGGACCGCTTGGCATAAGCAGGCAAACTGTTTACATTAAAACCCATTTCTATCAGAGTCACCCCAATGTCGGGCATGGTGGGCTGGGGTCCGTGCAATGGTGTTCAAAGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTACGCCTTAATTTAGGTT