ORFeome > taf9b ORF1 – XORFeome v1.0

taf9b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: taf9b
Gene ID: 973358
Gene Page ID: 973352
ORF Xenbase ID: 17299917

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123359
Original XGC clone length: 765

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ837531
dbEST ID: 79655233
Trimmed Sequence: ATGGAGCAGGCTAAAATGGCTTCGCCCAAGAGCGCCCCAAAAGATGCTCAGGTGATGGCCCAGATTTTGAAGGACATGGGGATTACGGAGTATGAACCTAGAGTAATTAACCAGATGTTGGAATTCACATACCGATATGTAACAACAATATTGGAGGATGCAAAGATTTACTCTAGTCATGCCAAAAAATCAGATGTTGATGCAGATGACGTAAGACTTGCAATTCAGTGTAGAACTGACCAGTCATTTACATCTCCTCCTCCACGAGATTTTTTACTAGATATTGCACGACAAAAGAACCAAACACCTCTGCCATTAATCAAACCATATGCTGGACCAAGGTTGCCACCGGATAGATACTGCTTGACTGCCCCAAACTATCGTCTTAAAACAGTACAGAAGAAGATTTCCTCTTCAGCAGGAAGAATAACCGTACCAAGATTAAGTATGGGGGCAGTAACCAGCAGACCAAGCACCCCAACTTTAGGAACACCATCTGCACAAACCGTTTCTGTTTCTAAATTGGGCACGCCTGTGTCACTAACTAGTCAGAGGTTTACCGTACAGATCCCAACCTCACAGACATCAGTTAAAACAGCTACTCCCACTACTACCACAGTTCAGAATGTTCTCATTAACCCCTTCCCTAATTGGCTCAAAGAATATTCTCATTACACAAAGCATGGTGTTCTCGCAGAATACCGCTAATGAATCCAAATCGCTAAACCCCAAACACAAAGAATAAAAAAAAATATAAAATCATGGTGCCAGCTTTTTTTGGTACAAAGTTGGGGGTTTAAAAGAAAGGACTTTGG
Full Trace Sequence: CGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGGCTAAAATGGCTTCGCCCAAGAGCGCCCCAAAAGATGCTCAGGTGATGGCCCAGATTTTGAAGGACATGGGGATTACGGAGTATGAACCTAGAGTAATTAACCAGATGTTGGAATTCACATACCGATATGTAACAACAATATTGGAGGATGCAAAGATTTACTCTAGTCATGCCAAAAAATCAGATGTTGATGCAGATGACGTAAGACTTGCAATTCAGTGTAGAACTGACCAGTCATTTACATCTCCTCCTCCACGAGATTTTTTACTAGATATTGCACGACAAAAGAACCAAACACCTCTGCCATTAATCAAACCATATGCTGGACCAAGGTTGCCACCGGATAGATACTGCTTGACTGCCCCAAACTATCGTCTTAAAACAGTACAGAAGAAGATTTCCTCTTCAGCAGGAAGAATAACCGTACCAAGATTAAGTATGGGGGCAGTAACCAGCAGACCAAGCACCCCAACTTTAGGAACACCATCTGCACAAACCGTTTCTGTTTCTAAATTGGGCACGCCTGTGTCACTAACTAGTCAGAGGTTTACCGTACAGATCCCAACCTCACAGACATCAGTTAAAACAGCTACTCCCACTACTACCACAGTTCAGAATGTTCTCATTAACCCCTTCCCTAATTGGCTCAAAGAATATTCTCATTACACAAAGCATGGTGTTCTCGCAGAATACCGCTAATGAATCCAAATCGCTAAACCCCAAACACAAAGAATAAAAAAAAATATAAAATCATGGTGCCAGCTTTTTTTGGTACAAAGTTGGGGGTTTAAAAGAAAGGACTTTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGGCTAAAATGG

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATTGCATCATAATCTTCTTCATCCTCGTGTTTGCGCTTTAGCGAGTTGGATTCATTAGCTGTATTCTGTGATGACACCATGTTTGTTGTAATGAGAATATTCTTTGAGCCAATTAGGGAGGGGTTAATGAGAACATTCTGAACTGTGGTAGTAGTTGGAGTAGCTGTTTTAACTGATGTCTGTGAGGTTGGGATCTGTACGGTAAACCTCTGACTAGTTAGTGACACAAGCGTGCCCGATTTAAAAACAGAAACAGTTTGTGCAGATGGTGTTCCTAAAATTGGGGTGGGTGGTCGGCTGGTGAGTGCCCCGATGCTTGATCGTGGTACGGTTATTCTTCCTACGGAAGAAGAAATCATCTTCTCTACTGGTTGAGTACAATCGTTTTGGGGAGGAGGACGGGGGGTAGGCCCCGCGAGGGGGCGCCCGGGGTAAAAAAAAATGAATGAAGAAGGGGTGTGGTGTGGTGGTTCATTCGTCGGGGAGTGGGGGGATCATGCAGGAGGGGAGGAGAGAAAATANAGAGTGTGAGACTTACTAGAAGGAGGGGCCCGCCTACCGTCCCGGGAGCACTATGTGTTTTTCTTGCGGACGGGGGGGGGGACTATAGGGCGCACGTGTTGTTGGGGGGGGTGGGGGGGGGGGGGGAGAGAAAAAAAAAAGGGGGTAAGAGACANGGGGGACAACGGCCGGGAAAAACAGGAGGGGGAGAGGGAGGGGGGGGGGGAAGGGGGGGGAGACGGTGGGGGGGGAAGGGAGGGAATAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATTGCATCATAATCTTCTTCATC