ORFeome > tagln ORF1 – XORFeome v1.0

tagln ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tagln
Gene ID: 6254653
Gene Page ID: 489084
ORF Xenbase ID: 17299923

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC061650
Original XGC clone length: 603

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ824757
dbEST ID: 79642459
Trimmed Sequence: ATGGCTAATAAAGGTCCTTCATATGGAATGAGCCGTGAGGTTCAGTCTCGTATCGAGAAGAAGTATGACGAGGAACTAGAGCAACGTCTCGTGCAGTGGATCAGTATGCAGTGCGGTGATGATGTCGGAACACCAGAACAAGGAAGGCTCGGCTTTCAACAATGGCTGAAGAATGGCCTGGTCCTCTCAAAGCTGATGAACAGTCTCTACCCAAAGGGTTCCCAGTCAGTGAAGATCCCTGATCCCCCTCCCAGCATGGTGTTTAAGCAGATGGAACAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGATTACGGGGTGGTTAAAACAGACATGTTCCAGACAGTAGACCTGTATGAAGGAAAGGACATGGCGGCTGTGCAAAGGACAATTGTGGCACTTGGAAGCATTGCTGTTACAAAGAATGATGGTCAATACAAAGGGGACCCATCTTGGTTTATGAAGAAAGCCCAGGAACACAAACGGGACTTCTCTGAAGAGAAACTGAAGGAGGGAAAGAATATCATTGGCTTGCAGATGGGGAGCAACCAAGGAGCCACCCAGTCTGGGATGACAGGATACGGTCGACCAAGACAAATTTGCTT
Full Trace Sequence: CAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTAATAAAGGTCCTTCATATGGAATGAGCCGTGAGGTTCAGTCTCGTATCGAGAAGAAGTATGACGAGGAACTAGAGCAACGTCTCGTGCAGTGGATCAGTATGCAGTGCGGTGATGATGTCGGAACACCAGAACAAGGAAGGCTCGGCTTTCAACAATGGCTGAAGAATGGCCTGGTCCTCTCAAAGCTGATGAACAGTCTCTACCCAAAGGGTTCCCAGTCAGTGAAGATCCCTGATCCCCCTCCCAGCATGGTGTTTAAGCAGATGGAACAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGATTACGGGGTGGTTAAAACAGACATGTTCCAGACAGTAGACCTGTATGAAGGAAAGGACATGGCGGCTGTGCAAAGGACAATTGTGGCACTTGGAAGCATTGCTGTTACAAAGAATGATGGTCAATACAAAGGGGACCCATCTTGGTTTATGAAGAAAGCCCAGGAACACAAACGGGACTTCTCTGAAGAGAAACTGAAGGAGGGAAAGAATATCATTGGCTTGCAGATGGGGAGCAACCAAGGAGCCACCCAGTCTGGGATGACAGGATACGGTCGACCAAGACAAATTTGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCNTTATCATTTGTTGNCACGAACAGGTCACTATCAGTCAAAATAAAAATCATATTTGCAATCCAGCTGATATCCCTANTTAGTGAGTCTATTACATGGTCCATAGCTGTTACTGCACTCTGCGCAATAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAANNNNNAAANACAN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTAATAAAGGTCCTTCATAT

Sequences - 3ʹ (reverse) EST

Accession: JZ830111
dbEST ID: 79647813
Trimmed Sequence: GCAAATTTGTCTTGGTCGACCGTATCCTGTCATCCCAGACTGGGTGGCTCCTTGGTTGCTCCCCATCTGCAAGCCAATGATATTCTTTCCCTCCTTCAGTTTCTCTTCAGAGAAGTCCCGTTTGTGTTCCTGGGCTTTCTTCATAAACCAAGATGGGTCCCCTTTGTATTGACCATCATTCTTTGTAACAGCAATGCTTCCAAGTGCCACAATTGTCCTTTGCACAGCCGCCATGTCCTTTCCTTCATACAGGTCTACTGTCTGGAACATGTCTGTTTTAACCACCCCGTAATCTTCAGCTGCCTTCAGGAACTGAGCCACCTGTTCCATCTGCTTAAACACCATGCTGGGAGGGGGATCAGGGATCTTCACTGACTGGGAACCCTTTGGGTAGAGACTGTTCATCAGCTTTGAGAGGACCAGGCCATTCTTCAGCCATTGTTGAAAGCCGAGCCTTCCTTGTTCTGGTGTTCCGACATCATCACCGCACTGCATACTGATCCACTGCACGAGACGTTGCTCTAGTTCCTCGTCATACTTCTTCTCGATACGAGACTGAACCTCACGGCTCAGTCCATATGAAGGACCTTTATTAGCCATGG
Full Trace Sequence: CAGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAAATTTGTCTTGGTCGACCGTATCCTGTCATCCCAGACTGGGTGGCTCCTTGGTTGCTCCCCATCTGCAAGCCAATGATATTCTTTCCCTCCTTCAGTTTCTCTTCAGAGAAGTCCCGTTTGTGTTCCTGGGCTTTCTTCATAAACCAAGATGGGTCCCCTTTGTATTGACCATCATTCTTTGTAACAGCAATGCTTCCAAGTGCCACAATTGTCCTTTGCACAGCCGCCATGTCCTTTCCTTCATACAGGTCTACTGTCTGGAACATGTCTGTTTTAACCACCCCGTAATCTTCAGCTGCCTTCAGGAACTGAGCCACCTGTTCCATCTGCTTAAACACCATGCTGGGAGGGGGATCAGGGATCTTCACTGACTGGGAACCCTTTGGGTAGAGACTGTTCATCAGCTTTGAGAGGACCAGGCCATTCTTCAGCCATTGTTGAAAGCCGAGCCTTCCTTGTTCTGGTGTTCCGACATCATCACCGCACTGCATACTGATCCACTGCACGAGACGTTGCTCTAGTTCCTCGTCATACTTCTTCTCGATACGAGACTGAACCTCACGGCTCAGTCCATATGAAGGACCTTTATTAGCCATGGTGCCCACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTCATCATTTTGTTTCAACGAACAGGGTCACTATCAGTACAAAATAAAAATAATTAATTTGGGGGCCGAGCTTTAGACTGGCTCATTTTACAATTCGGCGGGTGGTGTTGGTTGTGGGGGGGGGGGAAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAAATTTGTCTTGGTCGACCGTA