ORFeome > taldo1 ORF1 – XORFeome v1.0

taldo1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: taldo1
Gene ID: 1005385
Gene Page ID: 1005379
ORF Xenbase ID: 17299947

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084118
Original XGC clone length: 1017

Human orthology & disease relationships

NCBI Entrez ID: 6888
Ensembl gene IDs: ENSG00000177156
Directly associated (OMIM) disease MIM numbers: 606003
Indirectly associated (Lage, et al.) disease MIM numbers: 125851,223000,235700,602485,602579,606003

Library Location

Plate ID: GDExl11006
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ840065
dbEST ID: 79657767
Trimmed Sequence: ATGCCAAACAACCCTGTCAAGAAGCAGAAAATGGAGGAGTCGGCGCTGGATCAGCTAAAGCAGCACACTGTGGTGGTGGCCGATACTGGAGATTTTAATGCCATTGAAGAATACAAACCCCAGGATGCAACCACTAACCCATCGCTGATACTGGCAGCTGCACAAATGCCTGATTACCAGGGCCTAGTCAATGATGCCATTCAGTATGGAAAGAATCTCGGAGGGTCAGAAGAGGAGCAGATCAATAATATCATGGACAAGCTTTTTGTCTTGTTTGGAGTGGAAATCCTTAAGAAAATACCTGGTCGCGTTTCAACAGAGGTGGATGCCCGGCTATCTTTTGATAAAGATGGAATGGTGGAGCGTGCAAAGCGCCTTATAGCTCTCTACAAGGAAGCCGGCATTGACAAAAAAAGGATCCTGATCAAGCTTTCTTCAACATGGGAGGGCATACAAGCTGGCAAGATTCTGGAGGAAGAATATGGAATCCACTGCAACATGACCCTGCTGTTCTCCTTTGCCCAAGCAGTGGCATGTGCCGAGGCTGGCGTCACACTCATCTCTCCATTTGTGGGAAGGATCTTGGACTGGCATGTAGCAAACTCTGATACCAAGAGCTATGAGCCTTCCGAAGACCCAGGTGTGAAAAGTGTTGCCCAAATCCTACAATACAACCAAAAATTTGGCTACAAAACCTTTGGTGATGGGGGCATGCCTTCGGGAACACTGGGTGAAATCCAAGCCTCTTAAACCGAAGTTGATTAATCTACCCCATTCCCGCCCCAA
Full Trace Sequence: CAGGGGCCATATAATGGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCAAACAACCCTGTCAAGAAGCAGAAAATGGAGGAGTCGGCGCTGGATCAGCTAAAGCAGCACACTGTGGTGGTGGCCGATACTGGAGATTTTAATGCCATTGAAGAATACAAACCCCAGGATGCAACCACTAACCCATCGCTGATACTGGCAGCTGCACAAATGCCTGATTACCAGGGCCTAGTCAATGATGCCATTCAGTATGGAAAGAATCTCGGAGGGTCAGAAGAGGAGCAGATCAATAATATCATGGACAAGCTTTTTGTCTTGTTTGGAGTGGAAATCCTTAAGAAAATACCTGGTCGCGTTTCAACAGAGGTGGATGCCCGGCTATCTTTTGATAAAGATGGAATGGTGGAGCGTGCAAAGCGCCTTATAGCTCTCTACAAGGAAGCCGGCATTGACAAAAAAAGGATCCTGATCAAGCTTTCTTCAACATGGGAGGGCATACAAGCTGGCAAGATTCTGGAGGAAGAATATGGAATCCACTGCAACATGACCCTGCTGTTCTCCTTTGCCCAAGCAGTGGCATGTGCCGAGGCTGGCGTCACACTCATCTCTCCATTTGTGGGAAGGATCTTGGACTGGCATGTAGCAAACTCTGATACCAAGAGCTATGAGCCTTCCGAAGACCCAGGTGTGAAAAGTGTTGCCCAAATCCTACAATACAACCAAAAATTTGGCTACAAAACCTTTGGTGATGGGGGCATGCCTTCGGGAACACTGGGTGAAATCCAAGCCTCTTAAACCGAAGTTGATTAATCTACCCCATTCCCGCCCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAAACAACCCTGTCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ840064
dbEST ID: 79657766
Trimmed Sequence: TTTCCCATTTTCTGCACTGCAGAGGCGCTCCTTTAACATCTTCTCCAGCTTTATAGCATCAATGGCAAATTTCCTGATCCCGTCAGACAGTTTCTCCACTGCCATTTGGTCTTCGTTGTGCAGCCACCGGAATTCTTTCTCCTCCAAGTGCACTTTCTCCAGGTTGCTTGCTTGGGCCTCTTTAACCGTAAGCGCTGGGGTGAGCTTGCTGTTGTCTTTGGCCAACTCACTCAGCAGTTTAGGCGAGATGGTGAGATAATCACATCCGGTCAGAGCTTTGATTTCACCAGTGTTCCTGAAGGATGCCCCCATCACAATGGTTTTGTAGCCAAATTTTTTGTAGTAGTTGTAGATTTTGGCAACACTTTTCACACCTGGGTCTTCTGAAGGCTCATAGCTCTTGTTATCAGAGTTTGCTACATGCCAGTCCAAGATCCTTCCCACAAATGGAGAGATGAGTGTGACGCCNGCCTCGGCACATGCCACTGCTTGGGCAAAGGAGAACAGCAGGGTCATGTTGCAGTGGATTCCATATTCTTCCTCCGGAATCTTGCCAGCTTGTATGCCCTCCCATGTTAAAAAAAGCCTGATCAGGATCCTTTTTTTTTCAATGCCCGGCTCCCTGTAAAGAGCCATAAGGCGCTTTGCGACGCTCCACCATTCCATCTTTTATCAAATAATAACCCGGGGATCCCACCTCCTATCAAAACCCCA
Full Trace Sequence: AAAACGGCTATTGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCCCATTTTCTGCACTGCAGAGGCGCTCCTTTAACATCTTCTCCAGCTTTATAGCATCAATGGCAAATTTCCTGATCCCGTCAGACAGTTTCTCCACTGCCATTTGGTCTTCGTTGTGCAGCCACCGGAATTCTTTCTCCTCCAAGTGCACTTTCTCCAGGTTGCTTGCTTGGGCCTCTTTAACCGTAAGCGCTGGGGTGAGCTTGCTGTTGTCTTTGGCCAACTCACTCAGCAGTTTAGGCGAGATGGTGAGATAATCACATCCGGTCAGAGCTTTGATTTCACCAGTGTTCCTGAAGGATGCCCCCATCACAATGGTTTTGTAGCCAAATTTTTTGTAGTAGTTGTAGATTTTGGCAACACTTTTCACACCTGGGTCTTCTGAAGGCTCATAGCTCTTGTTATCAGAGTTTGCTACATGCCAGTCCAAGATCCTTCCCACAAATGGAGAGATGAGTGTGACGCCNGCCTCGGCACATGCCACTGCTTGGGCAAAGGAGAACAGCAGGGTCATGTTGCAGTGGATTCCATATTCTTCCTCCGGAATCTTGCCAGCTTGTATGCCCTCCCATGTTAAAAAAAGCCTGATCAGGATCCTTTTTTTTTCAATGCCCGGCTCCCTGTAAAGAGCCATAAGGCGCTTTGCGACGCTCCACCATTCCATCTTTTATCAAATAATAACCCGGGGATCCCACCTCCTATCAAAACCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCCCATTTTCTGCACTGC