ORFeome > tardbp ORF1 – XORFeome v1.0

tardbp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tardbp
Gene ID: 974459
Gene Page ID: 974452
ORF Xenbase ID: 17299983

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044271
Original XGC clone length: 738

Human orthology & disease relationships

NCBI Entrez ID: 23435
Ensembl gene IDs: ENSG00000120948,LRG_659
Directly associated (OMIM) disease MIM numbers: 612069
Indirectly associated (Lage, et al.) disease MIM numbers: 154500,253300,253400,253550,600334,603689,604145,608807,608808

Library Location

Plate ID: GDExl11013
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ824109
dbEST ID: 79641811
Trimmed Sequence: ATGGAGATGGAATACATAAGAGTGGCGGAGGATGAGAATGAAGAGCCAATGGAGATACCGTCTGAAGATGATGGGACAGTTCTGTTGTCTACAGTTACTGCCCAGTTTCCTGGTGCATGCGGTCTGAGATATAGAAACCCAGTGAATCAGTGCATGCGTGGTGTTCGATTGGTTGAAGGCATTCTCCATGCTCCTGAAAATGGCTGGGGAAACCTTGTGTATGTAGTCAATTATCCAAAAGATAACAAGAGGAAGATGGATGAAACTGATGCTTCCTCTGCAGTCAAAATTAAACGTGCAGTGACAAAAACATCAGATCTAATTGTATTAGGTCTTCCGTGGAAAACCACAGAACAAGATTTGAAAGACTATTTCAGCACATTTGGTGAAGTGATCATGGTGCAGGTAAAGAAAGATGCAAAGACAGGCCATTCTAAAGGATTTGGATTTGTCAGATTTACAGAGTATGAGACACAAGTAAAAGTGATGTCTCAGCGTCATATGATTGATGGCCGGTGGTGTGACTGCAAACTACCAAATTCTAAGAGTCCAGATGAACCTATGCGCAGCAGGAAGGTCTTTGTTGGGCGTTGCACAGAAGATATGAGTGCTGAGGAGCTTCGCCAGTTCTTCAGCAGTATGGAGAAAGTTGTGGATGTCTTTATTNCCAAAGCTTTCAGAGCANTTTCATTTGTTACATTTGCTGATGATCAGGTGCCCATCCCCCCGGGGGTGGTTGCCAACTTTCTTTTACCAAAGTTGGGGATATAAAAAAAAGCATTTTTTTTATTCAATTTGTTTTGCACCCAAAAGGGTTCCTATTCTGTTCAAAAAAAAAAAT
Full Trace Sequence: CAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGATGGAATACATAAGAGTGGCGGAGGATGAGAATGAAGAGCCAATGGAGATACCGTCTGAAGATGATGGGACAGTTCTGTTGTCTACAGTTACTGCCCAGTTTCCTGGTGCATGCGGTCTGAGATATAGAAACCCAGTGAATCAGTGCATGCGTGGTGTTCGATTGGTTGAAGGCATTCTCCATGCTCCTGAAAATGGCTGGGGAAACCTTGTGTATGTAGTCAATTATCCAAAAGATAACAAGAGGAAGATGGATGAAACTGATGCTTCCTCTGCAGTCAAAATTAAACGTGCAGTGACAAAAACATCAGATCTAATTGTATTAGGTCTTCCGTGGAAAACCACAGAACAAGATTTGAAAGACTATTTCAGCACATTTGGTGAAGTGATCATGGTGCAGGTAAAGAAAGATGCAAAGACAGGCCATTCTAAAGGATTTGGATTTGTCAGATTTACAGAGTATGAGACACAAGTAAAAGTGATGTCTCAGCGTCATATGATTGATGGCCGGTGGTGTGACTGCAAACTACCAAATTCTAAGAGTCCAGATGAACCTATGCGCAGCAGGAAGGTCTTTGTTGGGCGTTGCACAGAAGATATGAGTGCTGAGGAGCTTCGCCAGTTCTTCAGCAGTATGGAGAAAGTTGTGGATGTCTTTATTNCCAAAGCTTTCAGAGCANTTTCATTTGTTACATTTGCTGATGATCAGGTGCCCATCCCCCCGGGGGTGGTTGCCAACTTTCTTTTACCAAAGTTGGGGATATAAAAAAAAGCATTTTTTTTATTCAATTTGTTTTGCACCCAAAAGGGTTCCTATTCTGTTCAAAAAAAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGATGGAATACATAAGAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829417
dbEST ID: 79647119
Trimmed Sequence: CCACACAGAGATTGGGCAACCTGATCATCAGCAAATGTAACAAATGAAAATGCTCTGAAAGGCTTTGGAATAAAGACATCCACAACTTCTCCATACTGGCTGAAGAACTGGCGAAGCTCCTCAGCACTCATATCTTCTGTGCAACGCCCAACAAAGACCTTCCTGCTGCGCATAGGTTCATCTGGACTCTTAGAATTTGGTAGTTTGCAGTCACACCACCGGCCATCAATCATATGACGCTGAGACATCACTTTTACTTGTGTCTCATACTCTGTAAATCTGACAAATCCAAATCCTTTAGAATGGCCTGTCTTTGCATCTTTCTTTACCTGCACCATGATCACTTCACCAAATGTGCTGAAATAGTCTTTCAAATCTTGTTCTGTGGTTTTCCACGGAAGACCTAATACAATTAGATCTGATGTTTTTGTCACTGCACGTTTAATTTTGACTGCAGAGGAAGCATCAGTTTCATCCATCTTCCTCTTGTTATCTTTTGGATAATTGACTACATACCCAAGGTTTCCCCAGCCATTTTCAGGAGCATGGAAAATGCCTTCACCAATCGAACACCACTCAAGCACTGATTTACTGGGTTTCTATATCTCAAAACCGCAGGCACCAGGAAACTGGGGCAATAACTTGTAAACAACAGAAAATGTCCCCATCAATCTTTCAAAGGGAATCCTCCCTTTGGCCTCTTTCTTTCCCAATCTCTCCCCCAACCTCTTGATGTATTTCCCAATCTCCCCAGGTGGGTGCCCA
Full Trace Sequence: CTGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCACACAGAGATTGGGCAACCTGATCATCAGCAAATGTAACAAATGAAAATGCTCTGAAAGGCTTTGGAATAAAGACATCCACAACTTCTCCATACTGGCTGAAGAACTGGCGAAGCTCCTCAGCACTCATATCTTCTGTGCAACGCCCAACAAAGACCTTCCTGCTGCGCATAGGTTCATCTGGACTCTTAGAATTTGGTAGTTTGCAGTCACACCACCGGCCATCAATCATATGACGCTGAGACATCACTTTTACTTGTGTCTCATACTCTGTAAATCTGACAAATCCAAATCCTTTAGAATGGCCTGTCTTTGCATCTTTCTTTACCTGCACCATGATCACTTCACCAAATGTGCTGAAATAGTCTTTCAAATCTTGTTCTGTGGTTTTCCACGGAAGACCTAATACAATTAGATCTGATGTTTTTGTCACTGCACGTTTAATTTTGACTGCAGAGGAAGCATCAGTTTCATCCATCTTCCTCTTGTTATCTTTTGGATAATTGACTACATACCCAAGGTTTCCCCAGCCATTTTCAGGAGCATGGAAAATGCCTTCACCAATCGAACACCACTCAAGCACTGATTTACTGGGTTTCTATATCTCAAAACCGCAGGCACCAGGAAACTGGGGCAATAACTTGTAAACAACAGAAAATGTCCCCATCAATCTTTCAAAGGGAATCCTCCCTTTGGCCTCTTTCTTTCCCAATCTCTCCCCCAACCTCTTGATGTATTTCCCAATCTCCCCAGGTGGGTGCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCACACAGAGATTGGGCAAC