ORFeome > tbc1d10a ORF1 – XORFeome v1.0

tbc1d10a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tbc1d10a
Gene ID: 5813743
Gene Page ID: 5813720
ORF Xenbase ID: 17300031

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129516
Original XGC clone length: 1521

Human orthology & disease relationships

NCBI Entrez ID: 83874
Ensembl gene IDs: ENSG00000099992
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,153640,153650,155100,173900,600652,603622,605249,609322

Library Location

Plate ID: GDExl11086
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ837869
dbEST ID: 79655571
Trimmed Sequence: ATGGCGCGGAGCCCCGGGGAGGGCAACGTGTCCCCATCCGCCAGTTTACGAGGTACCAGAGAGACGCTGAATGACTCCGAGTTAGAGTCTGTGGGCTCAGACTCCGAGATCAACGGGTATGTGGCGGAGAGGAGGACCGACCGGTACGGCTTTCTTGTCAATCCTGAGTCCCAGGGAGAAAAGCAGGCGGAATTGCCAGTGGAGGTGCTGAGGCAGAGGGAGGCAAAATGGCTGGAGATGCTGGCAAACTGGGATAAATGGATGGCAAAGAAACACAAAAAGATAAAGCTGCGATGTCAAAAGGGAATCCCTCCTTCACTGCGTGGCCGTGCTTGGCAATATCTTTCAGGAAGGAAAGTGAAGACACCTATTTATT
Full Trace Sequence: TTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCGGAGCCCCGGGGAGGGCAACGTGTCCCCATCCGCCAGTTTACGAGGTACCAGAGAGACGCTGAATGACTCCGAGTTAGAGTCTGTGGGCTCAGACTCCGAGATCAACGGGTATGTGGCGGAGAGGAGGACCGACCGGTACGGCTTTCTTGTCAATCCTGAGTCCCAGGGAGAAAAGCAGGCGGAATTGCCAGTGGAGGTGCTGAGGCAGAGGGAGGCAAAATGGCTGGAGATGCTGGCAAACTGGGATAAATGGATGGCAAAGAAACACAAAAAGATAAAGCTGCGATGTCAAAAGGGAATCCCTCCTTCACTGCGTGGCCGTGCTTGGCAATATCTTTCAGGAAGGAAAGTGAAGACACCTATTTATTGCCAACTTTCGTGTACAGTTTTGGCATTATAAGAAAGCATTGCTTATCTTTTTGTTGCCACGAACATGTCTCTATCACTCAAAATAATATCTTTATTTCCCCTCCAGCAGATAACCTCTATTGTGACTCATATATACGTGCTATATCTGTCTTCTGGGCCGCTAAAAAAAAAAAAAAAATATCTATTATACAAAGGCCCTCGGAACCCCCCGGAAAAAAAAAAAACAACGCTCCTTAAAAAAAAAGGGGCGGTGTGTAAATCCTTTGTAAAAAAAAAAAACGCACAACCAAGGGAGAAAAAACCGGGTGGTGGGTTTAAATTAGGGTAGGAAAGGGGGGGGGGGGGCGCGCCCCACGGTGGACACAAAAAATTTGGAGAAAAAAGGGGGGGGGGGGGACGGGGGGGGGGGGGGTTTTTTTTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCGGAGCCCCGG

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGCCGGGGTATCAGCTATTGACCATGTAATACGACTCACTATTAGGGGATATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAATATGTGTCCTCACTTTCCTTCCAGAGATATAGTGCCAAGCACGGCCACGCAGTGAAAGAGGGATTCCCTTTTGACATCACATCTTTATCTTTTTGTGTCTCTTTGCCCTCCTTTTATCCCTTTTTGCCAACCTCTCCCCCCTTTTTGCCTCCCTCTGCCTCAACACCTCCTGTGGATACTCCCCCCGCTTTTCTCCCAGAGACTCGAGATTGACAAAAAACCCATACCGGTCGCTCCTCCTCTCCCCCACATACCCTTAGATCTCAGACTCAAACCCCACACACTCAAACTCAGACTCTTTCCGCCTCTCTGTGGTACCTCATAAACTGGCAGATGGACACACGTTGCCCTCCCCGGCGCTCCGCGCCGTGGTGCCATCTTTTTTATACAATTTTGGCTATATAAAAAAACATTGCTCATCATTTTTTTGCAACAAACAGCTCTCTATCACTCAAAATAATATCAATATTTGGCCCCCGATCTTAACACAAAAAAAAAAAAAAAAACCACATTACAGAGGAGCGCGAAACGCCCGGGGAAAAAAAGAAAAAAAAAAAACCCACAAAGGTGGTAAAAAAAAAATAAGGTGTAAGGGAGGGAAGCCACAACAGGAGGGGAGCCCCAGGGGAGGGGGTTGGTTTTTTATAATTGGGGGTGGGGGGGGGGGAGGCGGCGCAAAAAAAAGAAAAGAGCCGGGGGGGAGGAGGAGAGAGGAGNATNATAAAAGAGGGAGGCGGGGGAGNNNNNGNGNNAGNGGNNNGGCGCNGGANNGNGGGNNAAANNNGCGNGNGGAANNGNNGGGNGNGAGNNNNANNNNNNNAGAGANNNNNAGGAGGANGGCGGGGAAANGGGAAGGGAAGGAGAAGNGANGNNGNGGAAGGGGGNNNNNGGGGNNNNGGAGNGNANNGGNNGNNAANNGAGNNNGGGNNANANNNNNNNANNGGAANNGNGGNNNGAGAGNNNANNNNAGGGGNGGNGGNNNNNNNNAGGNNNGGAGGGAGAGGNNNNNAGNGGNGNNANNGNNGNANNNNGGGNNNGNNGGGGNNAGAANNGANNGNNGNNGAGNNGCNNNNNNNGGNGNNNNGNNGAAGGNAGAGGNNNGNGNGGAGGGNNNNGGGGGGGGGANNGGGNNGGGNNAGGNAGGGGGNANNGGANNGAGAAAGAGAGGNANGGNGGGGANG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAATAGGTGTCTTCACTTTCCTT