ORFeome > tbc1d16 ORF1 – XORFeome v1.0

tbc1d16 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tbc1d16
Gene ID: 986696
Gene Page ID: 986690
ORF Xenbase ID: 17300037

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057720
Original XGC clone length: 2184

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ824540
dbEST ID: 79642242
Trimmed Sequence: ATGTCTTTGGGCCGCCTTCTTCGTCGTGCTTCCTCCAAGGCCTCTGACTTCCTGACACTAGGTTCTGGGGGAGGAACATCCTCCGTATTGGATGGGGAAATTATTTTCTCCAAGAACAATGTTTGTGTGCATCCCCCAGAGCTGCTGCAGGATGTGGGATCCCATCACCCTGGGTACCTGTGTGTGTACATGGAGAAAGATGAGCTTTTGGGTACCACCTTAATCCTGGCCTGGGTCCCAAACGCCCGTATCCAGCGGCAGGATGAAGAGGCTCTGCGTTATATCACTCCTGAGAGTTCTCCTGTCCGCAAAAACCCACGTAAGAGAAACCGCCAACCTCCAGGCTCTGCTCCCACCACATGTAACAGACCTGCAGTTATCTCCAAAGAGGATCCAGGGAGAGACATTCATTTCCCTCTTGAGCAGGACCCTTCTTATGGCTCCACAGAGGGTGTTGAGGAAGTTACAGAGCAGGGGGAAGATGAAAGGTCTCTAGACTTATCTTCAGATGAAGTGAGTAAGGACAGCACCTTAGACTCAGATTCTGATGCCTTTTCCTCACCATTTTGCCTGTCTCCAATTAGCGAGGCCTTGGGGGAAAGCAGCAGCTCTGCATTTTTGGAAATGAAAATCGGGATGAGAGTAACAGTCATATGAGCAGCTATGTTTTTTGCCCCTGATGCCACTCTCAGCTGCTGGAGACAATGGGGCAGGTGTCCCTNGCAGGTGGGAAGAACAGCAGAAGCTTTTGGCCCTGGACACACCCGGTGGGGGTTTTTCAATGGGAACCGGGGTCCAAGCCCCTCCCTTCAATCCTTTTTCCCCATTTAAGC
Full Trace Sequence: ATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTTGGGCCGCCTTCTTCGTCGTGCTTCCTCCAAGGCCTCTGACTTCCTGACACTAGGTTCTGGGGGAGGAACATCCTCCGTATTGGATGGGGAAATTATTTTCTCCAAGAACAATGTTTGTGTGCATCCCCCAGAGCTGCTGCAGGATGTGGGATCCCATCACCCTGGGTACCTGTGTGTGTACATGGAGAAAGATGAGCTTTTGGGTACCACCTTAATCCTGGCCTGGGTCCCAAACGCCCGTATCCAGCGGCAGGATGAAGAGGCTCTGCGTTATATCACTCCTGAGAGTTCTCCTGTCCGCAAAAACCCACGTAAGAGAAACCGCCAACCTCCAGGCTCTGCTCCCACCACATGTAACAGACCTGCAGTTATCTCCAAAGAGGATCCAGGGAGAGACATTCATTTCCCTCTTGAGCAGGACCCTTCTTATGGCTCCACAGAGGGTGTTGAGGAAGTTACAGAGCAGGGGGAAGATGAAAGGTCTCTAGACTTATCTTCAGATGAAGTGAGTAAGGACAGCACCTTAGACTCAGATTCTGATGCCTTTTCCTCACCATTTTGCCTGTCTCCAATTAGCGAGGCCTTGGGGGAAAGCAGCAGCTCTGCATTTTTGGAAATGAAAATCGGGATGAGAGTAACAGTCATATGAGCAGCTATGTTTTTTGCCCCTGATGCCACTCTCAGCTGCTGGAGACAATGGGGCAGGTGTCCCTNGCAGGTGGGAAGAACAGCAGAAGCTTTTGGCCCTGGACACACCCGGTGGGGGTTTTTCAATGGGAACCGGGGTCCAAGCCCCTCCCTTCAATCCTTTTTCCCCATTTAAGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTTGGGCCGCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829892
dbEST ID: 79647594
Trimmed Sequence: TTTCTTGAAGGTAAACATATCAAGTGTTTTATGTCCCTTCTTGCCGTCCTTTGGATGCTTAGGGGATGGTTTTTCCATGGTACCTCCATATGGGCAGTTCTCAGACTCGGGGTGTTGACCAGTGCACTCAACAGGCGGAATGTAGCCACTATCCCACATGCCTGGGCTGCACAGTTTACATAAGTCATGTAGGCTGCAGGGAATCCTGGGTAACAGACGAAACTGATATAGCAAACTCCGTGCCTTTCTAAGGACAAGCTCTCCATTCATGTGCATTGCCAAGTTACTGAAATGCAGCAACATCTGGTCTGTTGGCAGCTGCTGCTCAATAACATCATCTCCATACAGAAAGATAATGGCGACACATAGGAAGAGATGGAAATAATCCGTCTGGTAATGGGCCCAACATGCTTCCCACATCCTCAGAGCTTCAGAATCTGGGAATTCCCTTTTGAAGCAAAGCAAGATCCAGCGATGGCAGAACAACATCTGGAGCCCATCTTCATCCAGAGATAGAAGGTGCTGATGAAAATGTGGGTGCACCAGTCGCAATAACTCTCGAAGGTACATCAGCTGCTTTTCCATATCTTCATCACATGGTGAGCTGATAAATATTGTGTTCTGCATCAGACCAACAAAACACCAAAACGTGTCAGACTCATCCAGGACTTCTGCCATTATGGGGGCCAACTAGGGTCTGACATACCCTGGTGAATAAACCAACTCCCCGGGCCTTGTCAGCGGGCCATAAT
Full Trace Sequence: GGCCGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTGAAGGTAAACATATCAAGTGTTTTATGTCCCTTCTTGCCGTCCTTTGGATGCTTAGGGGATGGTTTTTCCATGGTACCTCCATATGGGCAGTTCTCAGACTCGGGGTGTTGACCAGTGCACTCAACAGGCGGAATGTAGCCACTATCCCACATGCCTGGGCTGCACAGTTTACATAAGTCATGTAGGCTGCAGGGAATCCTGGGTAACAGACGAAACTGATATAGCAAACTCCGTGCCTTTCTAAGGACAAGCTCTCCATTCATGTGCATTGCCAAGTTACTGAAATGCAGCAACATCTGGTCTGTTGGCAGCTGCTGCTCAATAACATCATCTCCATACAGAAAGATAATGGCGACACATAGGAAGAGATGGAAATAATCCGTCTGGTAATGGGCCCAACATGCTTCCCACATCCTCAGAGCTTCAGAATCTGGGAATTCCCTTTTGAAGCAAAGCAAGATCCAGCGATGGCAGAACAACATCTGGAGCCCATCTTCATCCAGAGATAGAAGGTGCTGATGAAAATGTGGGTGCACCAGTCGCAATAACTCTCGAAGGTACATCAGCTGCTTTTCCATATCTTCATCACATGGTGAGCTGATAAATATTGTGTTCTGCATCAGACCAACAAAACACCAAAACGTGTCAGACTCATCCAGGACTTCTGCCATTATGGGGGCCAACTAGGGTCTGACATACCCTGGTGAATAAACCAACTCCCCGGGCCTTGTCAGCGGGCCATAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTGAAGGTAAACATATC