ORFeome > tbc1d24.1 ORF1 – XORFeome v1.0

tbc1d24.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tbc1d24.1
Gene ID: 981686
Gene Page ID: 981680
ORF Xenbase ID: 17300073

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128694
Original XGC clone length: 1689

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: E12

Sequences - 5สน (forward) EST

Accession: JZ837543
dbEST ID: 79655245
Trimmed Sequence: ATGGATGAAGCTGAATATGGCCGTTTTGTGGACTGGGACAAGATGGAAGCTGGTGGGCAAGAGCAAAGCCCTAAGGTGCTGAGCTGTACAGACTTCCAAGAATTGAAGCAGATGGCTCGCCAAGGACACTGGGCAAAGAGTCACACACTAAGGGCTAAGGTGTACCAAAAGCTGATCAAGGAGATACCCTGCCGTACTGTGACCCCCGACGCGTCTGTGTACCGTGACATAGTGGGTAAGATCGTGGGAAAGCGTTCTGCAAGCAGCCTCCCTCTCCCAGAATTTGTAGATGACCGCCAAATCCCCAGCTACAGTTTGAATTCCGAAGGCACTGGAGCTGTCCGGAAAATAATCTCATGTATCTCAAACCAGTTCCCAGACATTTCTTTCTGTCCTGCTCTTCCGTCCTTGGTGGCGCTGCTTCTCCATTACAGTCAGGACGAAGCCGAGTGCTTTGAAAACGTGTCCCGAATCTTGGCATGCAATGACCCCAATAGAAGACTTGTTGACCAAACCTTCTTGGCGTTCGAATCCTCCTGTATGACTTTCAGAGATCTTGCCGGCAAATATTGTCAAGGCCCCCACAAGCTCATGGGTGGCGGTGTCTGAAGATGTACTGGAGCTCTACTCTGACTGGCAAAAATGGATCTTTGGAGAACTGCCTTTCCCTTACCTTTACACCCCTGTTCAATGTGTTTCTTGGTAGAGG
Full Trace Sequence: GGGGGCCCCAAATAATGGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGAAGCTGAATATGGCCGTTTTGTGGACTGGGACAAGATGGAAGCTGGTGGGCAAGAGCAAAGCCCTAAGGTGCTGAGCTGTACAGACTTCCAAGAATTGAAGCAGATGGCTCGCCAAGGACACTGGGCAAAGAGTCACACACTAAGGGCTAAGGTGTACCAAAAGCTGATCAAGGAGATACCCTGCCGTACTGTGACCCCCGACGCGTCTGTGTACCGTGACATAGTGGGTAAGATCGTGGGAAAGCGTTCTGCAAGCAGCCTCCCTCTCCCAGAATTTGTAGATGACCGCCAAATCCCCAGCTACAGTTTGAATTCCGAAGGCACTGGAGCTGTCCGGAAAATAATCTCATGTATCTCAAACCAGTTCCCAGACATTTCTTTCTGTCCTGCTCTTCCGTCCTTGGTGGCGCTGCTTCTCCATTACAGTCAGGACGAAGCCGAGTGCTTTGAAAACGTGTCCCGAATCTTGGCATGCAATGACCCCAATAGAAGACTTGTTGACCAAACCTTCTTGGCGTTCGAATCCTCCTGTATGACTTTCAGAGATCTTGCCGGCAAATATTGTCAAGGCCCCCACAAGCTCATGGGTGGCGGTGTCTGAAGATGTACTGGAGCTCTACTCTGACTGGCAAAAATGGATCTTTGGAGAACTGCCTTTCCCTTACCTTTACACCCCTGTTCAATGTGTTTCTTGGTAGAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGAAGCTGAATATGGCCGT

Sequences - 3สน (reverse) EST

Accession: JZ837542
dbEST ID: 79655244
Trimmed Sequence: ATGCAAAGCAGAGTGAGCTCCATCGTTGTTCATGTTGTCCTTAAATCCCCACACCTCGATAATGGAGATCTGGAAGGTTTCGGAGCACAGAGGCTGGTTGTTGAAGGTGTTACAGTGACTGGTTCTGCCGTAGTTGAGGTCCGGGTCCAGGTATAAGGCCTGCCCATCGCCACCGCCAATAATAATGCAGTCTATGCTGCCAGCCATAAACATGGAGGCAGTTTTGGACGGGAGGTTGAAGTGCCGGGTAGCCAGGAATGGTGAGAGGCGACTGGAAGGATCAATGCCATCTTTGTCTGATTGGGAGGAGTTTGCTTCTTTGTCAGCAGAAAAAGAATTCACTTTGCCAAGTTCCGGGTGCTTTATTACAACCCACTCGTATCGCTCGACCTCTGGCTGTAACCGAAACACAAAGCATTCTCCTGTTCCAAAGAGACTCAGCTTATTGCCACTCCTCTTGCGCTCGCTCCAGTCTGTGGAAGGGAAAGCTCCACATACACTCCAGTTTTGTAGTTTGGGATCAAAAACAAGGGGCCAGCTCGTGCCCCTTCCCAAGTGAGAATAGGAACCTGCATAAGGCGGGTTCCCGGGCCCCCCAAATGGGGGAAAGAGCAGCCAAACGGCCTGGGGACCGGGGCGAGAACGTATCCGGAGAATCCAAGAAGGGGGAAATTTCCCCGCCCAATTTGTTTTTCCGGGGAAAGACAAATTTTTCGGGAAGGGTGAAAGAGTTTGGGCGCCGCGTTGAC
Full Trace Sequence: GGGGGAAACAGCTATGACCATGTAATACGACTCACTATATGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGCAAAGCAGAGTGAGCTCCATCGTTGTTCATGTTGTCCTTAAATCCCCACACCTCGATAATGGAGATCTGGAAGGTTTCGGAGCACAGAGGCTGGTTGTTGAAGGTGTTACAGTGACTGGTTCTGCCGTAGTTGAGGTCCGGGTCCAGGTATAAGGCCTGCCCATCGCCACCGCCAATAATAATGCAGTCTATGCTGCCAGCCATAAACATGGAGGCAGTTTTGGACGGGAGGTTGAAGTGCCGGGTAGCCAGGAATGGTGAGAGGCGACTGGAAGGATCAATGCCATCTTTGTCTGATTGGGAGGAGTTTGCTTCTTTGTCAGCAGAAAAAGAATTCACTTTGCCAAGTTCCGGGTGCTTTATTACAACCCACTCGTATCGCTCGACCTCTGGCTGTAACCGAAACACAAAGCATTCTCCTGTTCCAAAGAGACTCAGCTTATTGCCACTCCTCTTGCGCTCGCTCCAGTCTGTGGAAGGGAAAGCTCCACATACACTCCAGTTTTGTAGTTTGGGATCAAAAACAAGGGGCCAGCTCGTGCCCCTTCCCAAGTGAGAATAGGAACCTGCATAAGGCGGGTTCCCGGGCCCCCCAAATGGGGGAAAGAGCAGCCAAACGGCCTGGGGACCGGGGCGAGAACGTATCCGGAGAATCCAAGAAGGGGGAAATTTCCCCGCCCAATTTGTTTTTCCGGGGAAAGACAAATTTTTCGGGAAGGGTGAAAGAGTTTGGGCGCCGCGTTGAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGCAAAGCAGAGTGAGC