ORFeome > tbx3 ORF1 – XORFeome v1.0

tbx3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tbx3
Gene ID: 1018237
Gene Page ID: 1018230
ORF Xenbase ID: 17300211

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC077254
Original XGC clone length: 2136

Human orthology & disease relationships

NCBI Entrez ID: 6926
Ensembl gene IDs: ENSG00000135111
Directly associated (OMIM) disease MIM numbers: 181450
Indirectly associated (Lage, et al.) disease MIM numbers: 122880,148820,181450,193500,268220,609637

Library Location

Plate ID: GDExl11030
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ825924
dbEST ID: 79643626
Trimmed Sequence: ATGAATTTACCCATGAGAGACCCAGTAATTTCAGGGTCAGGCATGGCTTACCATCCATTCCTATCCCACAGGGCACCAGACTTTGCAATGAGTGCTGTTCTTGGACACCAACCTCCCTTTTTTCCAACCCTGGCTCTGCCACCCAATGGGGCTGCTCTTTCCCTTTCTAGTGCCCTGGCCAAGCCCATCATGGATCAATTAATGGGTGCCGCAGAGACTGGCATCCCCTTTTCATCTTTGGGTCATCAGGCAGCTGCTCATTTGAGGCCTCTTAAAACCCTTGAACCAGAAGAAGAAGTTGAAGACGATCCAAAAGTCCACCTGGAAGCCAAGGATCTCTGGGAACAGTTCCACAAAAGGGGAACAGAGATGGTCATCACAAAATCTGGGAGGAGAATGTTTCCTCCATTTAAAGTGAGGTGCTCTGGTCTGGACAAGAAAGCCAAATACATTCTACTGATGGACATTGTGGCTGCAGATGACTGCAGGTACAAGTTCCATAACTCCCGATGGATGGTGGCTGGAAAGGCAGACCCCGAAATGCCCAAACGAATGTATATCCACCCAGACAGCCCGGCCACTGGGGAGCAATGGATGTCCAAAGTAGTGAACTTCCATAAACTCAAACTGACCAACAATATCTCGGATAAACATGGATTTACTATTTTTAACTCCATGCACAAATACCAACCCCGGTTCCCCCATATTGCCAAGCTAATGAACTTTCTGAAATTTCCCTACAGCCACTTTCAGAAACATTAGGGTGTTCCCTGAAAAAAAAAAATCATTTGCAAGGT
Full Trace Sequence: GGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATTTACCCATGAGAGACCCAGTAATTTCAGGGTCAGGCATGGCTTACCATCCATTCCTATCCCACAGGGCACCAGACTTTGCAATGAGTGCTGTTCTTGGACACCAACCTCCCTTTTTTCCAACCCTGGCTCTGCCACCCAATGGGGCTGCTCTTTCCCTTTCTAGTGCCCTGGCCAAGCCCATCATGGATCAATTAATGGGTGCCGCAGAGACTGGCATCCCCTTTTCATCTTTGGGTCATCAGGCAGCTGCTCATTTGAGGCCTCTTAAAACCCTTGAACCAGAAGAAGAAGTTGAAGACGATCCAAAAGTCCACCTGGAAGCCAAGGATCTCTGGGAACAGTTCCACAAAAGGGGAACAGAGATGGTCATCACAAAATCTGGGAGGAGAATGTTTCCTCCATTTAAAGTGAGGTGCTCTGGTCTGGACAAGAAAGCCAAATACATTCTACTGATGGACATTGTGGCTGCAGATGACTGCAGGTACAAGTTCCATAACTCCCGATGGATGGTGGCTGGAAAGGCAGACCCCGAAATGCCCAAACGAATGTATATCCACCCAGACAGCCCGGCCACTGGGGAGCAATGGATGTCCAAAGTAGTGAACTTCCATAAACTCAAACTGACCAACAATATCTCGGATAAACATGGATTTACTATTTTTAACTCCATGCACAAATACCAACCCCGGTTCCCCCATATTGCCAAGCTAATGAACTTTCTGAAATTTCCCTACAGCCACTTTCAGAAACATTAGGGTGTTCCCTGAAAAAAAAAAATCATTTGCAAGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTTACCCATGAGAGACC

Sequences - 3ʹ (reverse) EST

Accession: JZ825923
dbEST ID: 79643625
Trimmed Sequence: ATCAGGGGAACCGCTCCTTGACAGCTCCTGCTTAGAATCCAGCCCGCTCACTAGCCGCTGAATATTTTGGAGCTCACTGCTTGCTTCCTTCTCTGGGCACAGCTTTGGGGATAAAGAGACGGAGCCAGAAGACAGGGTGGAGGATCTGCTGGTCAGTTCATTGTCCAGAGCAGTAGCGGCCGGACTGGAGAGGAGACTGGCTTTGCCATCCAGCGCGCCGTTGGGCAGAGAGTGCAGGGCAGTGGTGAGGAGGCTGTTGCTTTCTGCAAAGGGCATAGGGAAAGAGTACGGGTTGTACCTGAGCCTGGGGCGCATGGCGTTAAGAAAAGGGTGTCTGTGCACAGCAGAGGAGGCTGCAGCAGCCGCAGCCATGTACGTGTAAGGGTAGGAGAAAAGCCCTCCGAAGGGAGACATTGCCAGGCCCTGAGAGGCCAGGACTTGCTGCTGCAGGTGGAAAGGCAGTGCAGATGATCCCGCCAGCCCTTGACAGGAAGATGCCATGACGGTAAAGTCTATGCTGTTGATCCCAGGTGATGCTCCTGAAACTGAGGCCAGAAGTGGGTTTATGCCAACCGCCATATTGGAAAAAACCCCTCCCATTTGCAAGTTAAGTTGGGTGCAGGAGTAAAAGGTGTTAAGGGGCCCCAAAGGGTTAACAAAGACTGCTGCCAAGTTAGTTCCTAGGGGGAAAACCAAAGGTTTGTGCAAAAAGGCCCCGGGCCTGAAGCGGGGTGGGCCCCCTTGTGTGCCGTTTTTTCCCAACTTGAAAAAGGG
Full Trace Sequence: GGGGAAGAAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCAGGGGAACCGCTCCTTGACAGCTCCTGCTTAGAATCCAGCCCGCTCACTAGCCGCTGAATATTTTGGAGCTCACTGCTTGCTTCCTTCTCTGGGCACAGCTTTGGGGATAAAGAGACGGAGCCAGAAGACAGGGTGGAGGATCTGCTGGTCAGTTCATTGTCCAGAGCAGTAGCGGCCGGACTGGAGAGGAGACTGGCTTTGCCATCCAGCGCGCCGTTGGGCAGAGAGTGCAGGGCAGTGGTGAGGAGGCTGTTGCTTTCTGCAAAGGGCATAGGGAAAGAGTACGGGTTGTACCTGAGCCTGGGGCGCATGGCGTTAAGAAAAGGGTGTCTGTGCACAGCAGAGGAGGCTGCAGCAGCCGCAGCCATGTACGTGTAAGGGTAGGAGAAAAGCCCTCCGAAGGGAGACATTGCCAGGCCCTGAGAGGCCAGGACTTGCTGCTGCAGGTGGAAAGGCAGTGCAGATGATCCCGCCAGCCCTTGACAGGAAGATGCCATGACGGTAAAGTCTATGCTGTTGATCCCAGGTGATGCTCCTGAAACTGAGGCCAGAAGTGGGTTTATGCCAACCGCCATATTGGAAAAAACCCCTCCCATTTGCAAGTTAAGTTGGGTGCAGGAGTAAAAGGTGTTAAGGGGCCCCAAAGGGTTAACAAAGACTGCTGCCAAGTTAGTTCCTAGGGGGAAAACCAAAGGTTTGTGCAAAAAGGCCCCGGGCCTGAAGCGGGGTGGGCCCCCTTGTGTGCCGTTTTTTCCCAACTTGAAAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCAGGGGAACCGCTCCTT