ORFeome > tceb1 ORF1 – XORFeome v1.0

tceb1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tceb1
Gene ID: 6254689
Gene Page ID: 944974
ORF Xenbase ID: 17300253

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC055268
Original XGC clone length: 339

Human orthology & disease relationships

NCBI Entrez ID: 6921
Ensembl gene IDs: ENSG00000154582
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 151623,193300,194050,210900,214150,216400,223100,226730,275355,277700,278300,300049,300537,304120,305620,309350,311300,601675

Library Location

Plate ID: GDExl11003
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ839485
dbEST ID: 79657187
Trimmed Sequence: ATGGATGGTGAAGAGAAAACATATGGTGGCTGTGAGGGTCCTGATGCCATGTACGTAAAACTGATTTCATCTGATGGCCATGAATTTATTGTTAAAAGGGAACATGCTTTGACATCAGGAACAATAAAGGCCATGTTAAGTGGTCCAGGACAGTTTGCTGAAAATGAAACCAATGAAGTGAATTTCCGAGAGATTCCCTCCCATGTTCTATCTAAAGTCTGCATGTATTTTACCTACAAGGTTCGTTACACAAACAGCTCCACAGAAATCCCAGAATTTCCCATTGCGCCAGAGATCGCGCTGGAACTGCTGATGGCGGCAAACTTCCTAGACTGTTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGGTGAAGAGAAAACATATGGTGGCTGTGAGGGTCCTGATGCCATGTACGTAAAACTGATTTCATCTGATGGCCATGAATTTATTGTTAAAAGGGAACATGCTTTGACATCAGGAACAATAAAGGCCATGTTAAGTGGTCCAGGACAGTTTGCTGAAAATGAAACCAATGAAGTGAATTTCCGAGAGATTCCCTCCCATGTTCTATCTAAAGTCTGCATGTATTTTACCTACAAGGTTCGTTACACAAACAGCTCCACAGAAATCCCAGAATTTCCCATTGCGCCAGAGATCGCGCTGGAACTGCTGATGGCGGCAAACTTCCTAGACTGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCCTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGAAAAAAAAAAAAAAATCAAAATATTACATTCCAAGACTCCCCCCCCCCGGCAAAAAAAAAAAAAAAACCACCCCCACCAAAAATTGTTTTTGTGTTTCTTCTTGGCAGGGGGAAGGAGAACACCCCCCCCCACCCGCCCCTCCCTGCTTTGTGTTGGGGGGAAAAACACCCCGCAACGAACACGCAAAACTCCCCCCCAACACGGAGGGGAGGGGGGGGGGGGTGTTGGGTGGTTTTTTGTATTTTGAGAATATTTTTTGTTCCTCCTTACCTCCCAACCCCCCCCGCCCCACACCACCCGCCCCACACCCCCCAACAACGCGAAAGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGGTGAAGAGAAAACATAT

Sequences - 3ʹ (reverse) EST

Accession: JZ839484
dbEST ID: 79657186
Trimmed Sequence: ACAGTCTAGGAAGTTTGCCGCCATCAGCAGTTCCAGCGCGATCTCTGGCGCAATGGGAAATTCTGGGATTTCTGTGGAGCTGTTTGTGTAACGAACCTTGTAGGTAAAATACATGCAGACTTTAGATAGAACATGGGAGGGAATCTCTCGGAAATTCACTTCATTGGTTTCATTTTCAGCAAACTGTCCTGGACCACTTAACATGGCCTTTATTGTTCCTGATGTCAAAGCATGTTCCCTTTTAACAATAAATTCATGGCCATCAGATGAAATCAGTTTTACGTACATGGCATCAGGACCCTCACAGCCACCATATGTTTTCTCTTCACCATCCATGG
Full Trace Sequence: GAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACAGTCTAGGAAGTTTGCCGCCATCAGCAGTTCCAGCGCGATCTCTGGCGCAATGGGAAATTCTGGGATTTCTGTGGAGCTGTTTGTGTAACGAACCTTGTAGGTAAAATACATGCAGACTTTAGATAGAACATGGGAGGGAATCTCTCGGAAATTCACTTCATTGGTTTCATTTTCAGCAAACTGTCCTGGACCACTTAACATGGCCTTTATTGTTCCTGATGTCAAAGCATGTTCCCTTTTAACAATAAATTCATGGCCATCAGATGAAATCAGTTTTACGTACATGGCATCAGGACCCTCACAGCCACCATATGTTTTCTCTTCACCATCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGAAAAAAAAAATAACAAAAAAAAATAATTACCTATCCCCTTTCCCCCCCGCCCAGCGAAAAAAAAAAAAAAACCCTACCACCATACTGCTTTGGTTTTGTTGTTGTGGGGGGGAAAAAAAAACACCAACAAAAAAACACAAAGCGTGTGGGGTTTTTTTTTTTTATGTTGGGGGGGGGCGCGCCCCCNCCCCCACCCAAAAAAAAANGAGGGGGGGGGGGGGGGGGGGGGGTTTGTTTGTGTGTTGAAGGTGTGTTTTTTTTGAGTATNNGNGGAGCCANCCACCCNCGAGCCACACGGACGCCGGGGGGGGGGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGTCTAGGAAGTTTGCCGCCAT