ORFeome > tcerg1 ORF1 – XORFeome v1.0

tcerg1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tcerg1
Gene ID: 6253901
Gene Page ID: 6258414
ORF Xenbase ID: 17300265

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108484
Original XGC clone length: 1872

Human orthology & disease relationships

NCBI Entrez ID: 10915
Ensembl gene IDs: ENSG00000113649
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,120435,137750,137760,151623,158320,211980,275355,606657,608089,608354,608355

Library Location

Plate ID: GDExl11087
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ837949
dbEST ID: 79655651
Trimmed Sequence: ATGGCGGAACGCGGGGACACAGAGGCGGAGAGATATACCACCGATATTCGGATGGCACAGCAGCAACAAGCTTTGCGTTTTCGTGGCCCAGCGCCTCCACCCAGTCCGGTCATGAGGGGCCCGCCACCTCTTCTTCGTCCACCTCCTCCCTTTGCAATGATGCGTGGGCCTCCTCCACCTCCACGCCCTCCTTTTGGTCGTCCTCCTTTTGATCCTAGCATGCCACCAATACCTCCCCTAAGTGGAATCCCTCCACCTATTGCTCCTCCTCACCTACAGAGGCCGCCTTTCATGCCTCCGCATATAGGAAGTATGCCTCCTCCTGGAATGTTGTTTCCCCCTGGGATGCCGCCTGTTTCAACACCTGCAACAACTCCTACTCCCAGTCAAAGCCCTACACCTACACAAGCACCAACATTGCCCCCAAATGAGGAGATATGGGTAGAGAACAAGACTCCAGATGGGAAGGTGTATTATTATAATGCCCGGACTCGGGAGTCTGCATGGTCAAAACCAGATGGTGTGAAGGTCATCCAACAGTCACAACTGACTCCATTGATGGCAGCCCAGGCACAGGCCCAGGTTCAAGCAGCCCAGGCACAAGCCCAAGCTCAGGCTCAAGTACGGGTAGCACAGGCTCAAGCCCCAGGCAGCTCAAGCTCAAGTTGCTCATTCACAGCCCATCCCTTCTCAAAAGTGAACAGGGTGCCTCTCCCACACTAACAATATCTTTCATTTTTGGTTATTTACTTGAACAACCCCCTACTAACAAACCCAGCCCTCCTTTTTACCAAAATAAAACTCACCTTCAAAAACTCCATTTCT
Full Trace Sequence: CGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAACGCGGGGACACAGAGGCGGAGAGATATACCACCGATATTCGGATGGCACAGCAGCAACAAGCTTTGCGTTTTCGTGGCCCAGCGCCTCCACCCAGTCCGGTCATGAGGGGCCCGCCACCTCTTCTTCGTCCACCTCCTCCCTTTGCAATGATGCGTGGGCCTCCTCCACCTCCACGCCCTCCTTTTGGTCGTCCTCCTTTTGATCCTAGCATGCCACCAATACCTCCCCTAAGTGGAATCCCTCCACCTATTGCTCCTCCTCACCTACAGAGGCCGCCTTTCATGCCTCCGCATATAGGAAGTATGCCTCCTCCTGGAATGTTGTTTCCCCCTGGGATGCCGCCTGTTTCAACACCTGCAACAACTCCTACTCCCAGTCAAAGCCCTACACCTACACAAGCACCAACATTGCCCCCAAATGAGGAGATATGGGTAGAGAACAAGACTCCAGATGGGAAGGTGTATTATTATAATGCCCGGACTCGGGAGTCTGCATGGTCAAAACCAGATGGTGTGAAGGTCATCCAACAGTCACAACTGACTCCATTGATGGCAGCCCAGGCACAGGCCCAGGTTCAAGCAGCCCAGGCACAAGCCCAAGCTCAGGCTCAAGTACGGGTAGCACAGGCTCAAGCCCCAGGCAGCTCAAGCTCAAGTTGCTCATTCACAGCCCATCCCTTCTCAAAAGTGAACAGGGTGCCTCTCCCACACTAACAATATCTTTCATTTTTGGTTATTTACTTGAACAACCCCCTACTAACAAACCCAGCCCTCCTTTTTACCAAAATAAAACTCACCTTCAAAAACTCCATTTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAACGCGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837948
dbEST ID: 79655650
Trimmed Sequence: GAAAAGATTTATATACATCTCAAAAGATGGTTTTCTAACCCCTCTCTCCAGCAGCATATCTCTAAACTGTTTCATTCGAGAATCCAGGGGAACAATTGCTCTTTCACGAGCAGCTTTTATTTCGGCCTCCATCGCAGTTTCCTTATCAGCCTCTGGATCATCCTTCTTTCTCTTCTTTGCTTTTATAGGCTCATCGTCATTTGCATCTTCAGCAGAGTCTTGATCTTCTTTGTAATATTTCTTGCCATCCTCCCCTCTTTTATGCGGAGGCTCCTGAATGATTTTGTCTACATCAGCCCTTCCAATAAGGTCTTCTGGTCGGTCCCACATGGAAAGCCGAGTGGTGGGATTGTAGAAAAACACCCGTTCATCACCAGTCCACACAATGCACCATGGAGTGCCAGGGATTGGTGTAGTAGCCACTGGCCGGGCTTTTTGAGCTGCCTTTTCTTCCTCCGTCATCTCCTCCTCTTTTGGCTCCTCCTTTATCTCCTTGGGAGGTTCTTCCTTTAGTATTTCTTCTTCTGTATCCATTGCTTGAGGCTCTTCCTTAATAACGGCTTTTGGGTTTTGTCGATTCTTTTACCTTTTCAACCTCTTTATCTTTTTCTTTGAGTTTCCTGCGGTTTATCCCACGTTTATTCCAAAAGCCCTGGTATTGGAATATTATGTCTTTTCCTTCGGCTGTTTTAGATTCTGACCATTCTAACAATAATGGTGGCCCCCGCCTAAAGTTTGCAAGGAAAAACAACCCAAAAACCACCTTGGGGAAAAAGTAACT
Full Trace Sequence: AAAACCGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAAAGATTTATATACATCTCAAAAGATGGTTTTCTAACCCCTCTCTCCAGCAGCATATCTCTAAACTGTTTCATTCGAGAATCCAGGGGAACAATTGCTCTTTCACGAGCAGCTTTTATTTCGGCCTCCATCGCAGTTTCCTTATCAGCCTCTGGATCATCCTTCTTTCTCTTCTTTGCTTTTATAGGCTCATCGTCATTTGCATCTTCAGCAGAGTCTTGATCTTCTTTGTAATATTTCTTGCCATCCTCCCCTCTTTTATGCGGAGGCTCCTGAATGATTTTGTCTACATCAGCCCTTCCAATAAGGTCTTCTGGTCGGTCCCACATGGAAAGCCGAGTGGTGGGATTGTAGAAAAACACCCGTTCATCACCAGTCCACACAATGCACCATGGAGTGCCAGGGATTGGTGTAGTAGCCACTGGCCGGGCTTTTTGAGCTGCCTTTTCTTCCTCCGTCATCTCCTCCTCTTTTGGCTCCTCCTTTATCTCCTTGGGAGGTTCTTCCTTTAGTATTTCTTCTTCTGTATCCATTGCTTGAGGCTCTTCCTTAATAACGGCTTTTGGGTTTTGTCGATTCTTTTACCTTTTCAACCTCTTTATCTTTTTCTTTGAGTTTCCTGCGGTTTATCCCACGTTTATTCCAAAAGCCCTGGTATTGGAATATTATGTCTTTTCCTTCGGCTGTTTTAGATTCTGACCATTCTAACAATAATGGTGGCCCCCGCCTAAAGTTTGCAAGGAAAAACAACCCAAAAACCACCTTGGGGAAAAAGTAACT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAAAGATTTATATACATCTCAAA