ORFeome > tcf21 ORF1 – XORFeome v1.0

tcf21 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tcf21
Gene ID: 484809
Gene Page ID: 484804
ORF Xenbase ID: 17300277

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC073597
Original XGC clone length: 540

Human orthology & disease relationships

NCBI Entrez ID: 6943
Ensembl gene IDs: ENSG00000118526
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101400,180750

Library Location

Plate ID: GDExl11039
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ827498
dbEST ID: 79645200
Trimmed Sequence: ATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGACATGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGTTCAACCTGCGACAACGGTTCACCCAAAAAAGGTAGAGGGACTTCGGGCAAGAGGAGAAAAGCCTCCAGCAAGAAAAGTCCACTGGGCACCATCAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTAAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTCTGCGGCTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAGTATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCAGAAAACGACCTCAAGGAAGTGGTGAGCACTAGCCGATTGTGTGGTCCCACGGCATCTTT
Full Trace Sequence: GGGGTCTTAGTCGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGACATGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGTTCAACCTGCGACAACGGTTCACCCAAAAAAGGTAGAGGGACTTCGGGCAAGAGGAGAAAAGCCTCCAGCAAGAAAAGTCCACTGGGCACCATCAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTAAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTCTGCGGCTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAGTATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCAGAAAACGACCTCAAGGAAGTGGTGAGCACTAGCCGATTGTGTGGTCCCACGGCATCTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCCTATAGTGATCTTAATAAAAAAAAAAAAAAAAAAAAAAAGAAAAAATACGAGCCCAGGTCTCAAATTCTTTTTAAAAGTTTACAAANNNNNTNNTCNNCGTCCCGGNNTGTGGCTGGNTTTGTGTGTATTGCACTGTGGNGGGTGGN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCACCGGTTCTCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ827499
dbEST ID: 79645201
Trimmed Sequence: AGATGCCGTGGGACCACACAATCGGCTAGTGCTCACCACTTCCTTGAGGTCGTTTTCTGGTTTTCCAGCCACCCATAAAGGGCCAAGTCAGGTTAACTGGATGGATGTAGCCATTTTCATACTTGTCATTGGCTAGAATTTGACGCAGGTGAGCTATGTAACTAGATGCAAGCCGCAGAGTGTCCAGCTTGGAAAGTTTGGTGTCTGGAGGCACCCAAGGCAAAGTGGTCTTTAGCCTAGAAAAGGCTTTGCTTAGCACCCTCATCCTGGCTCTCTCCCTGGCATTGGCTGCATTCCTCTGGACCTGCTTGCCCTCCTGGTTGATGGTGCCCAGTGGACTTTTCTTGCTGGAGGCTTTTCTCCTCTTGCCCGAAGTCCCTCTACCTTTTTTGGGTGAACCGTTGTCGCAGGTTGAACTCTCCTCATTGCTGTCGTTGGATATGCCAAATTCTTTATTAGGATCCAGTTTGATGCCATCACATTCCAACATTTCCCTGTCTTGGAAGTCCTCCACATCCCTGAGAAAAACCGGTGGGACATGGTTGCCAACTTTTTTTTTCCAAATTTGGCAGTTAAAAAAGGCATTGCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATAAAATAAAAATAATTATTTTGGGGGCCCGAACGTAAGAACTGGGCCTTCGTTTTAAACATCCGTGGACCGTGGGGGGGAGANGGNNGGGANGGANAANGACAAAAAAGTTGNNGAANNNGGNGGAAGNNNGGAGGAANATGGGN
Full Trace Sequence: GGGTAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGATGCCGTGGGACCACACAATCGGCTAGTGCTCACCACTTCCTTGAGGTCGTTTTCTGGTTTTCCAGCCACCCATAAAGGGCCAAGTCAGGTTAACTGGATGGATGTAGCCATTTTCATACTTGTCATTGGCTAGAATTTGACGCAGGTGAGCTATGTAACTAGATGCAAGCCGCAGAGTGTCCAGCTTGGAAAGTTTGGTGTCTGGAGGCACCCAAGGCAAAGTGGTCTTTAGCCTAGAAAAGGCTTTGCTTAGCACCCTCATCCTGGCTCTCTCCCTGGCATTGGCTGCATTCCTCTGGACCTGCTTGCCCTCCTGGTTGATGGTGCCCAGTGGACTTTTCTTGCTGGAGGCTTTTCTCCTCTTGCCCGAAGTCCCTCTACCTTTTTTGGGTGAACCGTTGTCGCAGGTTGAACTCTCCTCATTGCTGTCGTTGGATATGCCAAATTCTTTATTAGGATCCAGTTTGATGCCATCACATTCCAACATTTCCCTGTCTTGGAAGTCCTCCACATCCCTGAGAAAAACCGGTGGGACATGGTTGCCAACTTTTTTTTTCCAAATTTGGCAGTTAAAAAAGGCATTGCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATAAAATAAAAATAATTATTTTGGGGGCCCGAACGTAAGAACTGGGCCTTCGTTTTAAACATCCGTGGACCGTGGGGGGGAGANGGNNGGGANGGANAANGACAAAAAAGTTGNNGAANNNGGNGGAAGNNNGGAGGAANATGGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGATGCCGTGGGACCACACAA