ORFeome > tcf3 ORF1 – XORFeome v1.0

tcf3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tcf3
Gene ID: 865159
Gene Page ID: 478264
ORF Xenbase ID: 17300283

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046840
Original XGC clone length: 1977

Human orthology & disease relationships

NCBI Entrez ID: 6929
Ensembl gene IDs: ENSG00000071564
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101400,180750

Library Location

Plate ID: GDExl11011
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ823908
dbEST ID: 79641610
Trimmed Sequence: ATGAATCAGCAGCAGAGGATGACAGCTGTGGGCACAGACAAGGAGTTAAGTGACCTCCTCGACTTTAGCATGATGTTCCCTCTACCTGTGGCTAATGGGAAGACCAGGCCTACTACTCTGGCCAGCACGCAGTTTGGAGGAGGATCAGGTTTGGAAGAGAGAACAGGCTCTGCACCATGGGGTACAGAAGATCACAACGGATCTACCTTTGACCAAGGAAGGGGTTATGGAGATGGAACACATTATGGGGAGCACAGGGAACTGCCATCACATGAAGGGAACTTATCTGCTCCATTCCTTGCTTCTGGTCTTGTAGGAAAAAATGATAGACCTCCTTATTCAACTTTTGGTAGAGACTCTGGGATGACAATGAATCAGACTGGATTTCTTTCTGGAGATTTGGCCATGAACAGTCCTTCTGCCCTGTCACCAAATGCAGGAAAAGCAGGGTCACAATATTATACATACCCCAACAACTCACGGCGGCGACCTGGAGATAGTAACCTTGATGCCCAGCCAAAAAAAGTGCGGAAGGTACCACCAGGACTGCCTTCTTCCGTTTACCCAGCAAACTCAGGTGATGAATACTGTGGTGACCGAGGAAGTTATGCCTCCACTAAGACGCCTAATTCAGTGTATCCTGGTGCATTCTACATGGCAGATGGACTTCACAGTTCCGATATCTGGGCTTCTCCAGGAGGGATTGGGACAAGGAGGTTACAGTTCAGTCCTGAANTAGCTCTTCAGTCTTCATTCTTCAAGACCACAGGGATTCAACAGCCTGCATCCCCCTGAAGCGAATGGGTTTTCTCATGCACTTCCCCGGGGGAGGGGAAAACCTTTTTGG
Full Trace Sequence: CAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATCAGCAGCAGAGGATGACAGCTGTGGGCACAGACAAGGAGTTAAGTGACCTCCTCGACTTTAGCATGATGTTCCCTCTACCTGTGGCTAATGGGAAGACCAGGCCTACTACTCTGGCCAGCACGCAGTTTGGAGGAGGATCAGGTTTGGAAGAGAGAACAGGCTCTGCACCATGGGGTACAGAAGATCACAACGGATCTACCTTTGACCAAGGAAGGGGTTATGGAGATGGAACACATTATGGGGAGCACAGGGAACTGCCATCACATGAAGGGAACTTATCTGCTCCATTCCTTGCTTCTGGTCTTGTAGGAAAAAATGATAGACCTCCTTATTCAACTTTTGGTAGAGACTCTGGGATGACAATGAATCAGACTGGATTTCTTTCTGGAGATTTGGCCATGAACAGTCCTTCTGCCCTGTCACCAAATGCAGGAAAAGCAGGGTCACAATATTATACATACCCCAACAACTCACGGCGGCGACCTGGAGATAGTAACCTTGATGCCCAGCCAAAAAAAGTGCGGAAGGTACCACCAGGACTGCCTTCTTCCGTTTACCCAGCAAACTCAGGTGATGAATACTGTGGTGACCGAGGAAGTTATGCCTCCACTAAGACGCCTAATTCAGTGTATCCTGGTGCATTCTACATGGCAGATGGACTTCACAGTTCCGATATCTGGGCTTCTCCAGGAGGGATTGGGACAAGGAGGTTACAGTTCAGTCCTGAANTAGCTCTTCAGTCTTCATTCTTCAAGACCACAGGGATTCAACAGCCTGCATCCCCCTGAAGCGAATGGGTTTTCTCATGCACTTCCCCGGGGGAGGGGAAAACCTTTTTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATCAGCAGCAGAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829217
dbEST ID: 79646919
Trimmed Sequence: CATGTGTCCCACTGGGTTGTGAGAGTCCCCAACGCCAGGGTGTCCTCCAGACAGGCCCATTTGAGGGTCAACACCTGAAACTTTCTCTTCCTCACGCCTCTTAAGACAGGCAGCTTTTGGGTTCAGGTTCCGCTCTCGCACTTGCTGCTCGAGGCTGAGGATGACAGAGACTGCCTGGTGCAGAATCAGTAGCTTAGTCTGCGGTTTCTCACTGTTGAGGTGCAGTTGACACATCCTCCCCAGCTCTTTAAAAGCTTCGTTGATGTCTTTGACACGAAGCCGCTCTCGAGCATTGTTAGCTACCCTTCTCTCCTTCTCACGCTCTGCTTTTTGCTCTGGGGGAAGGTTATCATCATCTTCATCTTCATCCTCATCTTGACTGTTAATTGAGCAGCGTGTCCGACTTCTCTGTGGCTTAGACTCTTTCTTCTCATCATCTGACAGATCTGCCACAGATCTGTTCTCCTCATCCTCTTTACTCTCCCTTTTTATATCTGGGACTCTGCCTGGAGGTATTGCCCTTCCAAGCCCCGGAAGCCCTGAGTAGGAATCCTGTGGTCTGGTTAGATCAGGAAGTGAACCTGGCTGTGCAGGAACAGTGACCTGGCTGTGCAGCATGTTGAAAGCACTAGGCAGGGCTTCTTCTGTGTTGAGAGTTTAACATAAAATGGTCAATTGGCAAGAAAAAAGCACACCAACCGGGAAAC
Full Trace Sequence: GCTGACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGTGTCCCACTGGGTTGTGAGAGTCCCCAACGCCAGGGTGTCCTCCAGACAGGCCCATTTGAGGGTCAACACCTGAAACTTTCTCTTCCTCACGCCTCTTAAGACAGGCAGCTTTTGGGTTCAGGTTCCGCTCTCGCACTTGCTGCTCGAGGCTGAGGATGACAGAGACTGCCTGGTGCAGAATCAGTAGCTTAGTCTGCGGTTTCTCACTGTTGAGGTGCAGTTGACACATCCTCCCCAGCTCTTTAAAAGCTTCGTTGATGTCTTTGACACGAAGCCGCTCTCGAGCATTGTTAGCTACCCTTCTCTCCTTCTCACGCTCTGCTTTTTGCTCTGGGGGAAGGTTATCATCATCTTCATCTTCATCCTCATCTTGACTGTTAATTGAGCAGCGTGTCCGACTTCTCTGTGGCTTAGACTCTTTCTTCTCATCATCTGACAGATCTGCCACAGATCTGTTCTCCTCATCCTCTTTACTCTCCCTTTTTATATCTGGGACTCTGCCTGGAGGTATTGCCCTTCCAAGCCCCGGAAGCCCTGAGTAGGAATCCTGTGGTCTGGTTAGATCAGGAAGTGAACCTGGCTGTGCAGGAACAGTGACCTGGCTGTGCAGCATGTTGAAAGCACTAGGCAGGGCTTCTTCTGTGTTGAGAGTTTAACATAAAATGGTCAATTGGCAAGAAAAAAGCACACCAACCGGGAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGTGTCCCACTGGGTT