ORFeome > tchp ORF1 – XORFeome v1.0

tchp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tchp
Gene ID: 963792
Gene Page ID: 963786
ORF Xenbase ID: 17300313

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124854
Original XGC clone length: 1500

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ838118
dbEST ID: 79655820
Trimmed Sequence: ATGGCTTTACCTACACTCCCATCTAATTGGCACAGCCGTAGCAGGGTTCTTGAGCAGCAGATAGTACGGCAGAGAGAGCAAGAAGCCAGATTACGTCATCAGTGGGATCAAACCAACCAATATTTTAAACAGTCCAATGTCTGCAGCAGCAAACAAGCACAGTGGAGTTCTCGGCAGTCTTATCAAAAAAGTATGAATGCATTTCACCAGGAGAAACAGAAGGAGGAGAAGAAAAAAACTTTAGAGTATCGTCGAGAACAGCTACGGAAACTGTTACAAGAGGAGCGAGATTTGCTAGAAGAAGAGCTGAAGGAGCTTCGTTGTAATAAAGAGCACAATGTTTCCGATATGAGGCAAAGGACAGAGGAGCTTAAGTCTGCAAGAAAAGAACGACAGAAGACACCTTGCAGAGGAATTGTTAGATGAAAAGCGGAAAAAGAATAAAAAGAATATGCGAGAAGATGCATCAAGTCACGTCAGAAAGCATGTGGGAGGATCAGAGCCGACAACATCGTTGTACTAGAACACAAGGTGGGGGGGGGGAAGGGGCAAAGGATTGGAGGAGGGAGTGCGGGCATGGGCCAGAGAAATGGAAAGGAGGAAAAAGATGGGCGTTGGAAAGACGGGGGGTGAGGTGAGGGGTGAGATTAGAGACTACTGAAGCGGCGGAGTTGGAGCGCGGGCGGGAGAATTTAGGAATGAGAGAAGGGGCGAAAGAGAAGGNAAAGGAAGGAAAGAAGGCGGCACGAACACGGGCTGAGGAAGCGGGATGAAGGAGATAGGGNGGGGGGACCAGCAGCA
Full Trace Sequence: TCGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTTACCTACACTCCCATCTAATTGGCACAGCCGTAGCAGGGTTCTTGAGCAGCAGATAGTACGGCAGAGAGAGCAAGAAGCCAGATTACGTCATCAGTGGGATCAAACCAACCAATATTTTAAACAGTCCAATGTCTGCAGCAGCAAACAAGCACAGTGGAGTTCTCGGCAGTCTTATCAAAAAAGTATGAATGCATTTCACCAGGAGAAACAGAAGGAGGAGAAGAAAAAAACTTTAGAGTATCGTCGAGAACAGCTACGGAAACTGTTACAAGAGGAGCGAGATTTGCTAGAAGAAGAGCTGAAGGAGCTTCGTTGTAATAAAGAGCACAATGTTTCCGATATGAGGCAAAGGACAGAGGAGCTTAAGTCTGCAAGAAAAGAACGACAGAAGACACCTTGCAGAGGAATTGTTAGATGAAAAGCGGAAAAAGAATAAAAAGAATATGCGAGAAGATGCATCAAGTCACGTCAGAAAGCATGTGGGAGGATCAGAGCCGACAACATCGTTGTACTAGAACACAAGGTGGGGGGGGGGAAGGGGCAAAGGATTGGAGGAGGGAGTGCGGGCATGGGCCAGAGAAATGGAAAGGAGGAAAAAGATGGGCGTTGGAAAGACGGGGGGTGAGGTGAGGGGTGAGATTAGAGACTACTGAAGCGGCGGAGTTGGAGCGCGGGCGGGAGAATTTAGGAATGAGAGAAGGGGCGAAAGAGAAGGNAAAGGAAGGAAAGAAGGCGGCACGAACACGGGCTGAGGAAGCGGGATGAAGGAGATAGGGNGGGGGGACCAGCAGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTACCTACACTCCCATCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838117
dbEST ID: 79655819
Trimmed Sequence: AGACCAAGCAGTTCTGGGGCGACTGTAAGTCTTCTTCTGGTATCCTCGCTGGGTCATAATCTCTGCCTCCTGTTGCAGTAAGTCATTCTCCAAATCCTCTGCAAGTTTAAACTCTTTCTCCTCCTCCTCCTGCTGTACAATGGCTTCCTTTCCCTTTAACAGCTGCTCAACAATCTGTGCTTCTAGTTCTGTCCTGCGGGCTGTTTTCTGTTCCTCCTCTTGCTTCTTCTCTCCCCTTGTAAATTGCCTGGCTTCTTCTACCTCTCTTAGGAGCCGCTCACGATTCATTACGAACTCAGCCTAAGAAAGCTGGTTCCTTTCTATGCGCTCCTGAATGTGCAACTGTCTTCCTGAGACCAGCTCGGATCTAAAGCTAAACCGTACATCCGTCTCACTCGGTGACGAAGACGCGATTAAGTGCATCCTTCGCTGAAGACTCTGGAGAAGAAACGAGATTAAGGTCGGGAGAGGGGAAGGAGAGAGAGAAGTCGCACCGTGGGACGAGAGGGGGCGGGTGCGAGGGAGAGAGAGAGGGAGGGGCAATGTTTAGAGAAGAGTAGATGGGACCGGAAGAANAGTGTGGAAAGAAGNGAAAGAAAGAGAAGAGAGGAGAGGAAGAGAGGCAGAGAGGTGAGTTAAGAGAGGACAGGAAAAGAAGANGGCCAGAGAGATGTTGAGAAAAAAAGAATTGGGAAGGGGAGGAAGAAGGTGGGAGAGAGAGGGGGAAGCAAANGGNATGAAGGGGGGGAAAAGGGAAANNAAGGGAGAGAACT
Full Trace Sequence: GGGCAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGACCAAGCAGTTCTGGGGCGACTGTAAGTCTTCTTCTGGTATCCTCGCTGGGTCATAATCTCTGCCTCCTGTTGCAGTAAGTCATTCTCCAAATCCTCTGCAAGTTTAAACTCTTTCTCCTCCTCCTCCTGCTGTACAATGGCTTCCTTTCCCTTTAACAGCTGCTCAACAATCTGTGCTTCTAGTTCTGTCCTGCGGGCTGTTTTCTGTTCCTCCTCTTGCTTCTTCTCTCCCCTTGTAAATTGCCTGGCTTCTTCTACCTCTCTTAGGAGCCGCTCACGATTCATTACGAACTCAGCCTAAGAAAGCTGGTTCCTTTCTATGCGCTCCTGAATGTGCAACTGTCTTCCTGAGACCAGCTCGGATCTAAAGCTAAACCGTACATCCGTCTCACTCGGTGACGAAGACGCGATTAAGTGCATCCTTCGCTGAAGACTCTGGAGAAGAAACGAGATTAAGGTCGGGAGAGGGGAAGGAGAGAGAGAAGTCGCACCGTGGGACGAGAGGGGGCGGGTGCGAGGGAGAGAGAGAGGGAGGGGCAATGTTTAGAGAAGAGTAGATGGGACCGGAAGAANAGTGTGGAAAGAAGNGAAAGAAAGAGAAGAGAGGAGAGGAAGAGAGGCAGAGAGGTGAGTTAAGAGAGGACAGGAAAAGAAGANGGCCAGAGAGATGTTGAGAAAAAAAGAATTGGGAAGGGGAGGAAGAAGGTGGGAGAGAGAGGGGGAAGCAAANGGNATGAAGGGGGGGAAAAGGGAAANNAAGGGAGAGAACT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACCAAGCAGTTCTGGGGCGA