ORFeome > tdgf1.2 ORF1 – XORFeome v1.0

tdgf1.2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tdgf1.2
Gene ID: 6252924
Gene Page ID: 876238
ORF Xenbase ID: 17300349

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124942
Original XGC clone length: 573

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ837257
dbEST ID: 79654959
Trimmed Sequence: ATGCTTTGCCGGGACCATGGGAGATTCATATTTATAACATTGACTCTACTGATCTTTCACTGTTACCAAAGGACTGGCATTAGAGGCAGTGGAATATTCTAGCAAAGGGAGTTCAAATACTACAAAAGAGGATCTACTGATAAATCATAGCAGGACTATTGACACTTTCCATAATCTAAACAAGGGCAACGAGAAAAGAAACCAGCATAAAACGGAAGGCCTTGTACCTTTCATTGGCCTTACAGACAGCAGCAAACTCAGCAAACATTGCTGCAATAATGGAGGAACATGTGTCCTGGGAAGTTTTTGTGTCTGTCCGAGGTATTTTACAGGACGATACTGTGAACATGATGAAAGAACAAAACACTGTGCAGCAAAGATCCAACATGGTGATTGGATACGCAAGGCCTGCCGTTTGTGTCGGTGCACATATGGGGTTCTTCATTGCTTTGTAGAAACACAGACTGATTGTGATGAAGTCGAAGAGGAAGAAATACATTCCAGTGCACCAATGGAACAATCCTCAATGTGCCTGATTGTATCTGGCATCCTTTTCTGCATTTATATGTGTTT
Full Trace Sequence: TCGAGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTTTGCCGGGACCATGGGAGATTCATATTTATAACATTGACTCTACTGATCTTTCACTGTTACCAAAGGACTGGCATTAGAGGCAGTGGAATATTCTAGCAAAGGGAGTTCAAATACTACAAAAGAGGATCTACTGATAAATCATAGCAGGACTATTGACACTTTCCATAATCTAAACAAGGGCAACGAGAAAAGAAACCAGCATAAAACGGAAGGCCTTGTACCTTTCATTGGCCTTACAGACAGCAGCAAACTCAGCAAACATTGCTGCAATAATGGAGGAACATGTGTCCTGGGAAGTTTTTGTGTCTGTCCGAGGTATTTTACAGGACGATACTGTGAACATGATGAAAGAACAAAACACTGTGCAGCAAAGATCCAACATGGTGATTGGATACGCAAGGCCTGCCGTTTGTGTCGGTGCACATATGGGGTTCTTCATTGCTTTGTAGAAACACAGACTGATTGTGATGAAGTCGAAGAGGAAGAAATACATTCCAGTGCACCAATGGAACAATCCTCAATGTGCCTGATTGTATCTGGCATCCTTTTCTGCATTTATATGTGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTGCCAACGACAAGGTCACCTTCAATCAAAATAAATCCATTATTGGCCTCCGCCCTAGTCCCCCCTTAAAGAAAAACAAATAAAAAAAAAAAAAAAATAAAACAAGGAAAGCTCTGGGCCCGGTCCAACCCCCACCCCCAAATTTATAAAAAAANNNNNNNCCGTCNGGAAAAGAAAAAGAGTTGTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTTGCCGGGACCATGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837256
dbEST ID: 79654958
Trimmed Sequence: ACACATATAAATGCAGAAAAGGATGCCAGATACAATCAGGCACATTGAGGATTGTTCCATTGGTGCACTGGAATGTATTTCTTCCTCTTCGACTTCATCACAATCAGTCTGTGTTTCTACAAAGCAATGAAGAACCCCATATGTGCACCGACACAAACGGCAGGCCTTGCGTATCCAATCACCATGTTGGATCTTTGCTGCACAGTGTTTTGTTCTTTCATCATGTTCACAGTATCGTCCTGTAAAATACCTCGGACAGACACAAAAACTTCCCAGGACACATGTTCCTCCATTATTGCAGCAATGTTTGCTGAGTTTGCTGCTGTCTGTAAGGCCAATGAAAGGTACAAGGCCTTCCGTTTTATGCTGGTTTCTTTTCTCGTTGCCCTTGTTTAGATTATGGAAAGTGTCAATAGTCCTGCTATGATTTATCAGTAGATCCTCTTTTGTAGTATTTGAACTCCCTTTGCTAGAATATTCCACTGCCTCTAATGCCAGTCCTTTGTAACAGTGAAAGATCAGTAAAGTCAATGTTATAAATATGAATCTCCCATGGTCCCGGCAAACATGG
Full Trace Sequence: AAAGAGGCTTATGACCATGTAATACGACTCACTATAGGGGGATATCAGTCTGGATGGAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACACATATAAATGCAGAAAAGGATGCCAGATACAATCAGGCACATTGAGGATTGTTCCATTGGTGCACTGGAATGTATTTCTTCCTCTTCGACTTCATCACAATCAGTCTGTGTTTCTACAAAGCAATGAAGAACCCCATATGTGCACCGACACAAACGGCAGGCCTTGCGTATCCAATCACCATGTTGGATCTTTGCTGCACAGTGTTTTGTTCTTTCATCATGTTCACAGTATCGTCCTGTAAAATACCTCGGACAGACACAAAAACTTCCCAGGACACATGTTCCTCCATTATTGCAGCAATGTTTGCTGAGTTTGCTGCTGTCTGTAAGGCCAATGAAAGGTACAAGGCCTTCCGTTTTATGCTGGTTTCTTTTCTCGTTGCCCTTGTTTAGATTATGGAAAGTGTCAATAGTCCTGCTATGATTTATCAGTAGATCCTCTTTTGTAGTATTTGAACTCCCTTTGCTAGAATATTCCACTGCCTCTAATGCCAGTCCTTTGTAACAGTGAAAGATCAGTAAAGTCAATGTTATAAATATGAATCTCCCATGGTCCCGGCAAACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAATAATGCATTGCTCATCCATTTGTTGCAACAAAGAGTCACTATCAGTCGGAATAAATTCAAAAAAAAAAAAAACGAAAAGAACAAAGTAGACGTCTGTTAAAACACTTCCGGTCACCGGGGGGNNNTGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACACATATAAATGCAGAAAAGGA