ORFeome > tdp2 ORF1 – XORFeome v1.0

tdp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tdp2
Gene ID: 967018
Gene Page ID: 967012
ORF Xenbase ID: 17300373

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC141728
Original XGC clone length: 1116

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ838870
dbEST ID: 79656572
Trimmed Sequence: ATGGAAGTGGAAGAAGCAGGCGCTGTACAGACTGGGACTGGGGAAGCAGTGGTGGCCAATGAGAGGACCAAACAATGTTCAGCGTTTGCCTCTATCACGGGTTGTGATGAGGCAGTTGCGCAGTGTTTCCTAGCTGAGAATGACTGGGATATGGAAAGGGCGATCAATTCTTACTTTGAGCCTGGGGTGGAGTCGACCTTACAAAACAAACCTGCAGCTGATCTAGCAGACCCTTTAAAGCAAGAGATGCATGCAGTTACCTCTGACGCATGTATTGACTTGACTAGCGATGACTTGGTGGCTACCAAATCATAAGCTGTTACCACCAACTCCTCTACTGTGAAACAACAAGAAGATGAGAGCCATTTTACCTTTCTTACATGGAATATAGATGGCCTTGATGAATCAAACGTTGCAGAGAGGGCTCGTGCTGTATGTTCCTGTTTGGCCCTGTACACTCCAGATGTAATATTTTTACAGGAGGTTATTCCACCCCACTGTGAGTACCTGAAGAAAAGGCCCGGCGTCTACAGAATTATTTCAGGTAATTGATGATGATACTTTTACTCTTTGATTTCTGAAAATTACCAAGGTAAAGTTGTTTTTCTACAGTTTTGACCATACCCTTCCCCTTAATGAGAGAGAAAGTTTGTTTTTTGCGATGGTGGACGTTTGGGGAGAAATGTGTGGCTTTGATAAGTCTGTTTTTAGAAGTCCAGGAGTATGCTTATAAAATAATTAATGTGGCTGTCCGTGGCCACTAGGGCCTAGGAGAAATAGATGAGATGGCGCCGCCCCGTGCGCGCTAGCGGCGCTTTGTT
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGTGGAAGAAGCAGGCGCTGTACAGACTGGGACTGGGGAAGCAGTGGTGGCCAATGAGAGGACCAAACAATGTTCAGCGTTTGCCTCTATCACGGGTTGTGATGAGGCAGTTGCGCAGTGTTTCCTAGCTGAGAATGACTGGGATATGGAAAGGGCGATCAATTCTTACTTTGAGCCTGGGGTGGAGTCGACCTTACAAAACAAACCTGCAGCTGATCTAGCAGACCCTTTAAAGCAAGAGATGCATGCAGTTACCTCTGACGCATGTATTGACTTGACTAGCGATGACTTGGTGGCTACCAAATCATAAGCTGTTACCACCAACTCCTCTACTGTGAAACAACAAGAAGATGAGAGCCATTTTACCTTTCTTACATGGAATATAGATGGCCTTGATGAATCAAACGTTGCAGAGAGGGCTCGTGCTGTATGTTCCTGTTTGGCCCTGTACACTCCAGATGTAATATTTTTACAGGAGGTTATTCCACCCCACTGTGAGTACCTGAAGAAAAGGCCCGGCGTCTACAGAATTATTTCAGGTAATTGATGATGATACTTTTACTCTTTGATTTCTGAAAATTACCAAGGTAAAGTTGTTTTTCTACAGTTTTGACCATACCCTTCCCCTTAATGAGAGAGAAAGTTTGTTTTTTGCGATGGTGGACGTTTGGGGAGAAATGTGTGGCTTTGATAAGTCTGTTTTTAGAAGTCCAGGAGTATGCTTATAAAATAATTAATGTGGCTGTCCGTGGCCACTAGGGCCTAGGAGAAATAGATGAGATGGCGCCGCCCCGTGCGCGCTAGCGGCGCTTTGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGTGGAAGAAGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838869
dbEST ID: 79656571
Trimmed Sequence: TAATATAATATCAAAGTCACACAGCAAACCCCAGTGATCACTTGGGAATCTGCCACAGTCCAGCTTTTCTGTGCCAACAAGGTTAAGAAACTGGGGGATGACTTGACTTCCTTCCATAGAAGCTCTATACAATATACGGTCAAAACGCAACCTGCTAGTATAGCAAGCTCTCAGATTGTTGTTCAGTTTTGTGTCCCAGGTATAGCGACAATGCTCAGGCTTACCCAAAAACTCCCAAACATCCAATATGGTATTTGGCAGACCTCCAATTTTAGCCACCTCCTGATCTCTCAGATTTGTATCTCCTCCAAATATTACAGTAGCTGAAGGGGGAGCATCCATCATCTTTTTAAGCACAGTGTCCAGCTGCTTTAATCGCTCCTTTGAATGATCTTTGGTGCTTTCTAGATGTGAAGTCATTAAGCATATACTATTGCCAGAGATGTTCACATTTGCTACAAGCAAATTTCTCATCATTAATGTGGATGGGTATGGTACAATTTCTTGACTAATTAACTTCACCCTGCTTTTTTTCAGCATCATACCAGTAAAGTATTCATCCTCATTACCTGTAATAATTTTGTAGCTGACGGCCCTCTTCCTCAGGTACTCACCGTATGGTGGAAATAACTTCCTGCCAAAATACTAAATCTGGAGTGGTCAGGGGCGAACCAGGAACATTCCGCCAGAAACCCCCCCCTTCCAACTTTGAATCCATCCGGGCCATCCTATTTTCCCGGTTAAAAAAAGGTAAAAGGTGGGCCTCC
Full Trace Sequence: GGCAAAAGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAATATAATATCAAAGTCACACAGCAAACCCCAGTGATCACTTGGGAATCTGCCACAGTCCAGCTTTTCTGTGCCAACAAGGTTAAGAAACTGGGGGATGACTTGACTTCCTTCCATAGAAGCTCTATACAATATACGGTCAAAACGCAACCTGCTAGTATAGCAAGCTCTCAGATTGTTGTTCAGTTTTGTGTCCCAGGTATAGCGACAATGCTCAGGCTTACCCAAAAACTCCCAAACATCCAATATGGTATTTGGCAGACCTCCAATTTTAGCCACCTCCTGATCTCTCAGATTTGTATCTCCTCCAAATATTACAGTAGCTGAAGGGGGAGCATCCATCATCTTTTTAAGCACAGTGTCCAGCTGCTTTAATCGCTCCTTTGAATGATCTTTGGTGCTTTCTAGATGTGAAGTCATTAAGCATATACTATTGCCAGAGATGTTCACATTTGCTACAAGCAAATTTCTCATCATTAATGTGGATGGGTATGGTACAATTTCTTGACTAATTAACTTCACCCTGCTTTTTTTCAGCATCATACCAGTAAAGTATTCATCCTCATTACCTGTAATAATTTTGTAGCTGACGGCCCTCTTCCTCAGGTACTCACCGTATGGTGGAAATAACTTCCTGCCAAAATACTAAATCTGGAGTGGTCAGGGGCGAACCAGGAACATTCCGCCAGAAACCCCCCCCTTCCAACTTTGAATCCATCCGGGCCATCCTATTTTCCCGGTTAAAAAAAGGTAAAAGGTGGGCCTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATATAATATCAAAGTCACACAG