ORFeome > tdrd5 ORF1 – XORFeome v1.0

tdrd5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tdrd5
Gene ID: 5884063
Gene Page ID: 5884031
ORF Xenbase ID: 17300391

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129060
Original XGC clone length: 2892

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ837344
dbEST ID: 79655046
Trimmed Sequence: ATGGAGCAGGAACGTATCATGCATTACCTGACAACAGCTGTACAGAAACCACAGCGATGAATCATCATAGTCTTCAGTGCCAAGTGAAAGCAGCCAATACTTAAGTTCTATGTACCAAAGAAACTATCCTTCAGGTTATAGATGAGGTTGACCCTGAGATGCCATATTTGGAAGCATTCCCCACAGACACAAATGTATGGGATGAAAACTGGGTTTTCTCTGATGGTGCATGTGGCAGTAACACCACTCCTACAATTCCTAAAGTTGAAACACAAAAACAGGAGAACAAAATCAGCAAAGAGCAGAAGCAGCCGTTCACATTTTGCATGAATTCTGGCGATGCCAATGTTGTTCATCGTCCATTGGAGGAATTTTACATCTCTTTAATCAAGTCAAGCAAGTCACAAGAAAGTACTGACATACAGCAGTCTTCCCATACACAGGAGCATCATTTGGCTGAGAAATCACACAAATGTACAGCAGAGCAGCTCCTAGGTGGTTCTTCATCAAGTATGCTTTGTGAAAAAAAACTATATTATGAAAACAAGGACCTTACATATTGTCAGCAGCAGTCATAGTGCAGTTTCATCCCACTTATAGGATTTCAGAAGCTTCAATTCCTAANAAGTGCGACACCAAGCGGCTTTAGGACCTGCAGCTCGACTTGCTACTGCTGGCAGATTATTGTACTGGGGCAGTGACTCAAATTTGCCAACTTTTCTTTGTACAAGTTGGCATAATAAGAAAACATTGCCTTATCAATTTGTTTGCAACAAACAGGGTCCCTAATAATTAAAAATAAAATCAATTAATTGCC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGGAACGTATCATGCATTACCTGACAACAGCTGTACAGAAACCACAGCGATGAATCATCATAGTCTTCAGTGCCAAGTGAAAGCAGCCAATACTTAAGTTCTATGTACCAAAGAAACTATCCTTCAGGTTATAGATGAGGTTGACCCTGAGATGCCATATTTGGAAGCATTCCCCACAGACACAAATGTATGGGATGAAAACTGGGTTTTCTCTGATGGTGCATGTGGCAGTAACACCACTCCTACAATTCCTAAAGTTGAAACACAAAAACAGGAGAACAAAATCAGCAAAGAGCAGAAGCAGCCGTTCACATTTTGCATGAATTCTGGCGATGCCAATGTTGTTCATCGTCCATTGGAGGAATTTTACATCTCTTTAATCAAGTCAAGCAAGTCACAAGAAAGTACTGACATACAGCAGTCTTCCCATACACAGGAGCATCATTTGGCTGAGAAATCACACAAATGTACAGCAGAGCAGCTCCTAGGTGGTTCTTCATCAAGTATGCTTTGTGAAAAAAAACTATATTATGAAAACAAGGACCTTACATATTGTCAGCAGCAGTCATAGTGCAGTTTCATCCCACTTATAGGATTTCAGAAGCTTCAATTCCTAANAAGTGCGACACCAAGCGGCTTTAGGACCTGCAGCTCGACTTGCTACTGCTGGCAGATTATTGTACTGGGGCAGTGACTCAAATTTGCCAACTTTTCTTTGTACAAGTTGGCATAATAAGAAAACATTGCCTTATCAATTTGTTTGCAACAAACAGGGTCCCTAATAATTAAAAATAAAATCAATTAATTGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGGAACGTATCATGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837343
dbEST ID: 79655045
Trimmed Sequence: ATGTGAGTCACTGGCCCAGTACAATAATCTGCCAGCAGTAGCAAGTCGAGCTGCAGGTCCTAAAGCCGCTGGTGTTGCACTTCTAGGAATCTGAAGCTTCTGAAATCCTATAAGTGGGCTGAAACTGCACTTTGACTGCTGCTGACAATATGTAAGGTCCTTGTTTTCATAATATAGTTTTTTTTCACAAAGCATACTTGATGAAGAACCACCTTGGAGCTGCTCTGCTGTACATCTGTGTGATTTCTCAGCCAAATGCTGCTCCTCTGTATGGGAAGACTGCTGTATGTCAGTACTTTCTTGTGACTTGCTTGACTTGATTAAAGAGATGTAAAATTCCTCCAATGGACGATGAACAACACTGGCATCGCCAGAATCCATGCAAAATTTGAACGGCTGCTTCTGCTCTTTGCTGAATACGTTCTCCCGCTGTTGTGTCTCCTCTTTAGTAATTGTATGACTGTAGTTACTGCCATCGCTCCCAACTCAGAACACCCAATCTCTTCACTATCACTCAAACTCAAATCATTAGTGGTTCGCCGGAGCGAAAAACGAACGCACGGCTCCACGCCCTGACTGAAGAGTTAGTTGGGGACATGAATATACGATGAGGGGCGTTACCGTGGCAGGAAATATCGTGAAGAATAACACAGAGACTTCCCTTCAGTACGTGGCCGGGTAGGGGGTGAGAGAATGCGGAGCCCTGTGTCCCNAGCTGTAGGGAAGGAGGGTGGGTTATTTAGAAAAGACCTTGGCCGCNGTACATTTTAGGAAACACAAAA
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGTGAGTCACTGGCCCAGTACAATAATCTGCCAGCAGTAGCAAGTCGAGCTGCAGGTCCTAAAGCCGCTGGTGTTGCACTTCTAGGAATCTGAAGCTTCTGAAATCCTATAAGTGGGCTGAAACTGCACTTTGACTGCTGCTGACAATATGTAAGGTCCTTGTTTTCATAATATAGTTTTTTTTCACAAAGCATACTTGATGAAGAACCACCTTGGAGCTGCTCTGCTGTACATCTGTGTGATTTCTCAGCCAAATGCTGCTCCTCTGTATGGGAAGACTGCTGTATGTCAGTACTTTCTTGTGACTTGCTTGACTTGATTAAAGAGATGTAAAATTCCTCCAATGGACGATGAACAACACTGGCATCGCCAGAATCCATGCAAAATTTGAACGGCTGCTTCTGCTCTTTGCTGAATACGTTCTCCCGCTGTTGTGTCTCCTCTTTAGTAATTGTATGACTGTAGTTACTGCCATCGCTCCCAACTCAGAACACCCAATCTCTTCACTATCACTCAAACTCAAATCATTAGTGGTTCGCCGGAGCGAAAAACGAACGCACGGCTCCACGCCCTGACTGAAGAGTTAGTTGGGGACATGAATATACGATGAGGGGCGTTACCGTGGCAGGAAATATCGTGAAGAATAACACAGAGACTTCCCTTCAGTACGTGGCCGGGTAGGGGGTGAGAGAATGCGGAGCCCTGTGTCCCNAGCTGTAGGGAAGGAGGGTGGGTTATTTAGAAAAGACCTTGGCCGCNGTACATTTTAGGAAACACAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTGAGTCACTGGCCCAGTACAA