ORFeome > tesc ORF1 – XORFeome v1.0

tesc ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tesc
Gene ID: 991117
Gene Page ID: 991110
ORF Xenbase ID: 17300475

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084830
Original XGC clone length: 645

Human orthology & disease relationships

NCBI Entrez ID: 54997
Ensembl gene IDs: ENSG00000088992
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 182290

Library Location

Plate ID: GDExl11006
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ839968
dbEST ID: 79657670
Trimmed Sequence: ATGGGATTATCACATTCTCACTCTGTGGAGACCAGGGAACTAGTGGAAAAGACTGGCTTCTCTGCAGAACAGATTGAACATTTGCACAAGAGATTCAAGAGTTTAAGTGGAGACGAGCCAACCATCAGGAGGGGGCACTTAAATGATATTTCAGATTTGGTCCTGAATCCTATCCGATCAAAAATAATAGATGCCTTTTTTGACAAACGGAACTTACGGAAAGGACCGAGTGGATATGTAGAAGAAATTAACTTTGAGGAGTTTCTGATTATAATGTCCTATTTTCGCCCCCTGAGTCAGCATATGGATGAAGAAAACATAAGTGTGTGTCGGACAGACAAGCTGAGATTTCTCTTCAACATGTACGATTCAGACAATGACAACAAGATTACCCTGGAGGAATACAGAAAAGTGGTAGAAGAACTCTTATCTGGAAATCCTAACATTGAAAAGGAAATGGCAAGATCCATTGCAGATGGAGCAATGCTGGAAGCTGCCAGCATTTGTGTTGGGCAAATGGAACCTGACCAAGTATATGAGGGAATTACATTCGACGACTTCCTCAAGATCTGGGAGGGGATCGATATTGAGACTAAAATGCACATCCGATTCCTGAACATGGAGAGCATTCCTTCCTGCCGCTT
Full Trace Sequence: TCGGGGCACCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGATTATCACATTCTCACTCTGTGGAGACCAGGGAACTAGTGGAAAAGACTGGCTTCTCTGCAGAACAGATTGAACATTTGCACAAGAGATTCAAGAGTTTAAGTGGAGACGAGCCAACCATCAGGAGGGGGCACTTAAATGATATTTCAGATTTGGTCCTGAATCCTATCCGATCAAAAATAATAGATGCCTTTTTTGACAAACGGAACTTACGGAAAGGACCGAGTGGATATGTAGAAGAAATTAACTTTGAGGAGTTTCTGATTATAATGTCCTATTTTCGCCCCCTGAGTCAGCATATGGATGAAGAAAACATAAGTGTGTGTCGGACAGACAAGCTGAGATTTCTCTTCAACATGTACGATTCAGACAATGACAACAAGATTACCCTGGAGGAATACAGAAAAGTGGTAGAAGAACTCTTATCTGGAAATCCTAACATTGAAAAGGAAATGGCAAGATCCATTGCAGATGGAGCAATGCTGGAAGCTGCCAGCATTTGTGTTGGGCAAATGGAACCTGACCAAGTATATGAGGGAATTACATTCGACGACTTCCTCAAGATCTGGGAGGGGATCGATATTGAGACTAAAATGCACATCCGATTCCTGAACATGGAGAGCATTCCTTCCTGCCGCTTGCCAACTTTCTTGTACAAAGTTGGCATTAATAAAAAGCAATGCTTATCAATTTGTTTGCACGAAAAAGGTCACTAACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGATTATCACATTCTCACTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839967
dbEST ID: 79657669
Trimmed Sequence: GCGGCAGGATGGAATGCTCTCCATGTTCAGGAATCGGATGTGCATTTTAGTCTCAATATCGATCCCCTCCCAGATCTTGAGGAAGTCGTCGAATGTAATTCCCTCATATACCTGGTCAGGTTCCATTTGCCCAACACAAATGCTGGCAGCTTCCAGCATTGCTCCATCTGCAATGGATCTTGCCATTTCCTTTTCAATGTTAGGATTTCCAGATAAGAGTTCTTCTACCACTTTTCTGTATTCCTCCAGGGTAATCTTGTTGTCATTGTCTGAATCGTACATGTTGAAGAGAAATCTCAGCTTGTCTGTCCGACACACACTTATGTTTTCTTCATCCATATGCTGACTCAGGGGGCGAAAATAGGACATTATAATCAGAAACTCCTCAAAGTTAATTTCTTCTACATATCCACTCGGTCCTTTCCGTAAGTTCCGTTTGTCAAAAAAGGCATCTATTATTTTTGATCGGATAGGATTCAGGACCAAATCTGAAATATCATTTAAGTGCCCCCTCCTGATGGTTGGCTCGTCTCCGCTTAAACTCTTGAATCTCTAGTGCAAATGTTCAATCTGTTCTGCCTAGAAGCCAGTCTTTTTCACTAGTTCCCTGGTCTCCCCAGAGTGAGAATG
Full Trace Sequence: GGGAAAATGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGGCAGGATGGAATGCTCTCCATGTTCAGGAATCGGATGTGCATTTTAGTCTCAATATCGATCCCCTCCCAGATCTTGAGGAAGTCGTCGAATGTAATTCCCTCATATACCTGGTCAGGTTCCATTTGCCCAACACAAATGCTGGCAGCTTCCAGCATTGCTCCATCTGCAATGGATCTTGCCATTTCCTTTTCAATGTTAGGATTTCCAGATAAGAGTTCTTCTACCACTTTTCTGTATTCCTCCAGGGTAATCTTGTTGTCATTGTCTGAATCGTACATGTTGAAGAGAAATCTCAGCTTGTCTGTCCGACACACACTTATGTTTTCTTCATCCATATGCTGACTCAGGGGGCGAAAATAGGACATTATAATCAGAAACTCCTCAAAGTTAATTTCTTCTACATATCCACTCGGTCCTTTCCGTAAGTTCCGTTTGTCAAAAAAGGCATCTATTATTTTTGATCGGATAGGATTCAGGACCAAATCTGAAATATCATTTAAGTGCCCCCTCCTGATGGTTGGCTCGTCTCCGCTTAAACTCTTGAATCTCTAGTGCAAATGTTCAATCTGTTCTGCCTAGAAGCCAGTCTTTTTCACTAGTTCCCTGGTCTCCCCAGAGTGAGAATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGGCAGGATGGAATGCT