ORFeome > tesk1 ORF1 – XORFeome v1.0

tesk1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tesk1
Gene ID: 6252925
Gene Page ID: 6458447
ORF Xenbase ID: 17300481

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC124941
Original XGC clone length: 948

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ837449
dbEST ID: 79655151
Trimmed Sequence: ATGTGTGAGTCTGCCCTCCTACCCTCCCCACCGTCCAGCCCGTTCTACGGGGAATCCGCCGACACCTATTTCCATGTTGACCGCTGGCAGAAACTGCGCACCGCCGTCAGGAAGCTGGAATTCTGGGAAAGCTTCAGCGCTGAGCTGATCGGCAGTGGATTCTTTTCCAAGGTCTATAAGGTGACACAGGGTATTGGATCTAAGTCGATGGTGGTGAAAATTTACAAAAACGATGTCGATGAGGAGGGAATTGTCCGAGAGATCACTTTGCTTCAAAAATTTTCTCACCCTAATATTGTAAGGTATCTTGGAATATGCGTCAAGGATGAGAAATTGCATCCAATATTGGAGTATGTGAATGGGGGGTGCCTGGAAGAGCTACTGGCCACTAAAGAGCTCCCCCTCAGCTGGAGAGACAAAGTGGAACTGTCCTGTGACATCAGCAGGGGGATGGTCTATCTGCACTCCAAGAATATCTACCACCGGGACCTCAATTCCAAGAACTGCCTGATCAGGGTGACCCCACGGGGCAGGGAGGCCGTGGTGACGGATTTCGGCCTCGCTCGGGAGGTCGGGGAGCTGCCATTGAAGAATGGGGAGCGCAAGTTGTCTCTGGTTTGATCTGCCTTTTGTATGGCACCGGAGATGCTGCGGGGGGAGCCGTATGACAAAAAGGTACACGTTCTTTTCCTTCGGGATCGTTCTGTGCAAAAATTTTGGGCCGGAATCCTGCCGAACCCCAAAACCTTCCCCCCCCACCGCAAATTTCGGGTTTATAATTTTAAGTGATTTTAAGAGAAAAAATGGTCCCCAGGTT
Full Trace Sequence: TCGGGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTGAGTCTGCCCTCCTACCCTCCCCACCGTCCAGCCCGTTCTACGGGGAATCCGCCGACACCTATTTCCATGTTGACCGCTGGCAGAAACTGCGCACCGCCGTCAGGAAGCTGGAATTCTGGGAAAGCTTCAGCGCTGAGCTGATCGGCAGTGGATTCTTTTCCAAGGTCTATAAGGTGACACAGGGTATTGGATCTAAGTCGATGGTGGTGAAAATTTACAAAAACGATGTCGATGAGGAGGGAATTGTCCGAGAGATCACTTTGCTTCAAAAATTTTCTCACCCTAATATTGTAAGGTATCTTGGAATATGCGTCAAGGATGAGAAATTGCATCCAATATTGGAGTATGTGAATGGGGGGTGCCTGGAAGAGCTACTGGCCACTAAAGAGCTCCCCCTCAGCTGGAGAGACAAAGTGGAACTGTCCTGTGACATCAGCAGGGGGATGGTCTATCTGCACTCCAAGAATATCTACCACCGGGACCTCAATTCCAAGAACTGCCTGATCAGGGTGACCCCACGGGGCAGGGAGGCCGTGGTGACGGATTTCGGCCTCGCTCGGGAGGTCGGGGAGCTGCCATTGAAGAATGGGGAGCGCAAGTTGTCTCTGGTTTGATCTGCCTTTTGTATGGCACCGGAGATGCTGCGGGGGGAGCCGTATGACAAAAAGGTACACGTTCTTTTCCTTCGGGATCGTTCTGTGCAAAAATTTTGGGCCGGAATCCTGCCGAACCCCAAAACCTTCCCCCCCCACCGCAAATTTCGGGTTTATAATTTTAAGTGATTTTAAGAGAAAAAATGGTCCCCAGGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGAGTCTGCCCTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837448
dbEST ID: 79655150
Trimmed Sequence: GCAGGCGTTCTGATTGGACGCCTGAGACTCCAGCACTTCGGCCAGGTCTTCCAGTTGGTCGAGAATCTCCCCAAATGAGGGTCTTTTGAAAGCTTCCAGCCGGCAACAGGTGACGGTTAGGTCCAACATTTGCTTGGGGCAACCTGGGACCATCTCCTTGAATGCCGTAACATCTAACCCGAAATCCCGTGTGCGCGGAAGGATCTCCGGGTCGGCAGGGATCCGGCCCAGAATTTCGCACAGAACGATCCCGAAGGAGAAGACGTCGACCTTTCTGTCATACGGCTCCCCCCGCAGCATCTCCGGTGCCAGCCAAAAGGCAGATCCGACCAGAGACAACTTGCGCTCCCCATTCTTCAATGGCAGCTCCCCGACCTCCCGAGCGAGGCCGAAATCCCTCACCACGGCCTCCCTGCCCCGTGGGGTCACCCTGATCAAGCAGTTCTTGTAGTTGATGTCCCGCTGGTGGAGAATCTTGGCAGGCGGAGGAACGAAGCCCCTGCTGATGTCACATGACGGTTCCACTTTCGTCGCTCGGGTGAGGGGGGAGGGGGTTAGTGGCCGATGAGCTCCTCCTGCTCGGGGCGCCCTTCCTTGGCCGGCGCTAGGATTCGAGGTGCTCAACCTTTTACGCGGGGGGGCAGAAATACTTCTACCAAATGAGGGGTGGGGGGGGGGTTGGAAATACAAGAGGGGGGGGGGGGGGAGATTTCCGGGCCCACATCCACACCCCCATTTTTTCTGGGGTTGTTTGTGTGGTGGGAAGGGAGGTAAGAAAAAACCCA
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAGGCGTTCTGATTGGACGCCTGAGACTCCAGCACTTCGGCCAGGTCTTCCAGTTGGTCGAGAATCTCCCCAAATGAGGGTCTTTTGAAAGCTTCCAGCCGGCAACAGGTGACGGTTAGGTCCAACATTTGCTTGGGGCAACCTGGGACCATCTCCTTGAATGCCGTAACATCTAACCCGAAATCCCGTGTGCGCGGAAGGATCTCCGGGTCGGCAGGGATCCGGCCCAGAATTTCGCACAGAACGATCCCGAAGGAGAAGACGTCGACCTTTCTGTCATACGGCTCCCCCCGCAGCATCTCCGGTGCCAGCCAAAAGGCAGATCCGACCAGAGACAACTTGCGCTCCCCATTCTTCAATGGCAGCTCCCCGACCTCCCGAGCGAGGCCGAAATCCCTCACCACGGCCTCCCTGCCCCGTGGGGTCACCCTGATCAAGCAGTTCTTGTAGTTGATGTCCCGCTGGTGGAGAATCTTGGCAGGCGGAGGAACGAAGCCCCTGCTGATGTCACATGACGGTTCCACTTTCGTCGCTCGGGTGAGGGGGGAGGGGGTTAGTGGCCGATGAGCTCCTCCTGCTCGGGGCGCCCTTCCTTGGCCGGCGCTAGGATTCGAGGTGCTCAACCTTTTACGCGGGGGGGCAGAAATACTTCTACCAAATGAGGGGTGGGGGGGGGGTTGGAAATACAAGAGGGGGGGGGGGGGGAGATTTCCGGGCCCACATCCACACCCCCATTTTTTCTGGGGTTGTTTGTGTGGTGGGAAGGGAGGTAAGAAAAAACCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGGCGTTCTGATTGG