ORFeome > tf ORF2 – XORFeome v1.0

tf ORF2 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tf
Gene ID: 6255495
Gene Page ID: 480505
ORF Xenbase ID: 17300511

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054950
Original XGC clone length: 1599

Human orthology & disease relationships

NCBI Entrez ID: 7018
Ensembl gene IDs: ENSG00000091513
Directly associated (OMIM) disease MIM numbers: 209300
Indirectly associated (Lage, et al.) disease MIM numbers: 118400,124900,125800,161800,176200,209300,261100,301000,313900,600652,603278,603622,605249,608232,608751,608971

Library Location

Plate ID: GDExl11001
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ839236
dbEST ID: 79656938
Trimmed Sequence: ATGGATCTTTCTCTCCGTGTGGCACTGTGCCTGAGCATGCTGGCCCTGTGCCTGGCAATACAAAAAGAAAAGCAGGTGCGCTGGTGTGTAAAATCAAACAGTGAACTCAAAAAGTGCAAAGATCTGGTAGACACGTGCAAAAACAAGGAAATCAAATTGTCCTGCGTAGAAAAATCCAATACTGATGAGTGTTTCACTGCTATTCAGGAAGATCATGCAGATGCAATTTGTGTGGACGGAGGGGATGTGTACAAAGGATCTCTACAACCTTATAACCTGAAGCCAATCATGGCAGAAAACTATGGTTCACATACAGAAACGGACACATGTTACTATGCAGTGGCAGTGGTAAAAAAATCCAGCAAATTTACATTTGATGAGCTGAAAGATAAAAAATCATGCCATACGGGAATTGGCAAGACTGCTGGATGGAATATCATCATTGGATTACTCCTGGAGAAAAAGCTGTTGAAATGGGCAGGGCCAGATTCAGAAACATTGGAGAAAGCGGTTTCAAAATTCTTCAAAGCCAGCTGTGTCCCCGGAGCCAAAGAGCCTAAATTGTGCCAGCTGTGTGCCGGAATTAAAGAGCATAAGTGCTCACGCTCTAACAACCAGCCGTACTACAACTACGCTGGTGCATTCAATTGTTTGCAAGAATAACAGGGAGATGTTGCTTTTTGTGAAGCAATCAACCGGTACCAAAAGGAATTCCAAAAAAAATAAAAAACCTTCTTGTGCCCCCGGATAAATCCAAGAAAAAAGGCCAAAAAGGGGAAATTTAAAAAATTTG
Full Trace Sequence: CTCGGGGCACAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCTTTCTCTCCGTGTGGCACTGTGCCTGAGCATGCTGGCCCTGTGCCTGGCAATACAAAAAGAAAAGCAGGTGCGCTGGTGTGTAAAATCAAACAGTGAACTCAAAAAGTGCAAAGATCTGGTAGACACGTGCAAAAACAAGGAAATCAAATTGTCCTGCGTAGAAAAATCCAATACTGATGAGTGTTTCACTGCTATTCAGGAAGATCATGCAGATGCAATTTGTGTGGACGGAGGGGATGTGTACAAAGGATCTCTACAACCTTATAACCTGAAGCCAATCATGGCAGAAAACTATGGTTCACATACAGAAACGGACACATGTTACTATGCAGTGGCAGTGGTAAAAAAATCCAGCAAATTTACATTTGATGAGCTGAAAGATAAAAAATCATGCCATACGGGAATTGGCAAGACTGCTGGATGGAATATCATCATTGGATTACTCCTGGAGAAAAAGCTGTTGAAATGGGCAGGGCCAGATTCAGAAACATTGGAGAAAGCGGTTTCAAAATTCTTCAAAGCCAGCTGTGTCCCCGGAGCCAAAGAGCCTAAATTGTGCCAGCTGTGTGCCGGAATTAAAGAGCATAAGTGCTCACGCTCTAACAACCAGCCGTACTACAACTACGCTGGTGCATTCAATTGTTTGCAAGAATAACAGGGAGATGTTGCTTTTTGTGAAGCAATCAACCGGTACCAAAAGGAATTCCAAAAAAAATAAAAAACCTTCTTGTGCCCCCGGATAAATCCAAGAAAAAAGGCCAAAAAGGGGAAATTTAAAAAATTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCTTTCTCTCCGTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839235
dbEST ID: 79656937
Trimmed Sequence: CTGGCACTGGGGGAACACTTTTTTTGCGCTCTCCGACAGCTTTTCCGGATCACCAATACACAGCGCGCACAGATTAGATTTCACATCAGAACCGGGAGCACAGCTTTCACCCACGTAACTAGCAAAATCACAGTTCCCGGTTTCACTGGTAATTAGTCCGACGGGTATGTTCCAGCCAGCTGTACGTCCAACAGCAGTGTGACATGTCTTTACTCCTCTAAGATTGCTCCATGAGACTTGTGTTCCCTTCTTTACAATGGCTACAGCATAATATACACCTTTTGCCTGTGAAGAACTCCGTTGGCATGGTGTTAGGTCATCTTGGTCGTAGTACTCTCCCATTACTGGAACCAACCCACATAGCCCTGCAGTGTACATGTAGCCTCCATCCAAAGTGACTGCGTCAGCATCACCTTTCAGAATCTGTACGATACATTCTTCAGCAGTGGAGGCCTCAGTGCATTCAATGGCGCCACCACTAATAGTTGTCCAGTCATCACACTTGGTTTTTTCTGCCTTGCTTTGTGTACACCAACGAACTTTCACTTGAGCCGCAGAGTCATCCTCCTTCACCCCTTCCTTCAGTGCTTGGATGGCATTTGGAATAATCCGCCTCCGAGGAACAAAAAACTGTCCAAAGAAAAAGGGAAGGGGGAATAAAACTCACCGGCGCTGGTCTTTAAAAAATAAAATCCTTTCCCATAACGGGAAACTTAAAAAATTTTTACTTTCTTTGGTGTTTCCCGGGGCCTTCCCTTTGGAAGGAA
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGCACTGGGGGAACACTTTTTTTGCGCTCTCCGACAGCTTTTCCGGATCACCAATACACAGCGCGCACAGATTAGATTTCACATCAGAACCGGGAGCACAGCTTTCACCCACGTAACTAGCAAAATCACAGTTCCCGGTTTCACTGGTAATTAGTCCGACGGGTATGTTCCAGCCAGCTGTACGTCCAACAGCAGTGTGACATGTCTTTACTCCTCTAAGATTGCTCCATGAGACTTGTGTTCCCTTCTTTACAATGGCTACAGCATAATATACACCTTTTGCCTGTGAAGAACTCCGTTGGCATGGTGTTAGGTCATCTTGGTCGTAGTACTCTCCCATTACTGGAACCAACCCACATAGCCCTGCAGTGTACATGTAGCCTCCATCCAAAGTGACTGCGTCAGCATCACCTTTCAGAATCTGTACGATACATTCTTCAGCAGTGGAGGCCTCAGTGCATTCAATGGCGCCACCACTAATAGTTGTCCAGTCATCACACTTGGTTTTTTCTGCCTTGCTTTGTGTACACCAACGAACTTTCACTTGAGCCGCAGAGTCATCCTCCTTCACCCCTTCCTTCAGTGCTTGGATGGCATTTGGAATAATCCGCCTCCGAGGAACAAAAAACTGTCCAAAGAAAAAGGGAAGGGGGAATAAAACTCACCGGCGCTGGTCTTTAAAAAATAAAATCCTTTCCCATAACGGGAAACTTAAAAAATTTTTACTTTCTTTGGTGTTTCCCGGGGCCTTCCCTTTGGAAGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGCACTGGGGGAACACT