ORFeome > tfap2e ORF1 – XORFeome v1.0

tfap2e ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tfap2e
Gene ID: 876809
Gene Page ID: 876802
ORF Xenbase ID: 17300547

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC111478
Original XGC clone length: 1305

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ837914
dbEST ID: 79655616
Trimmed Sequence: ATGCTGGTACACGCGTACTCTGCCATGGATCGCTCTGAAGTTTTGAATGGAGCAGCCAGCGGCGGCCGACTCTCCCAGCTGTCATCTCTCAACCAAGGGCCCTACAGCTCGGCCCCTCCACTGTGCCACACGCCGGCGTCCGACTTTCAGCCCCCCTACTTCCCTCCCCCGTACCCCCAACCTCCTTTATCTTACTCCCAGAGCCAGGAGTCCGGATACCCACACCTCGGCGACCCCTACAGCAGCATCAACTCCATCCACCACCAGCACCAGCAGCCCTCCTGGCACACCCCGCGGAGCCGCCCGGAGGAGGCAGGACTCCTCTCCCAAACTCACAGGGGACTCAGTCTGGACCCACGGAGAGACTACGGGGGAATGTCCCGCCTCATCCCTGGTTTGACAGACGGGGGTCACAGCCTGGCAGACAGCTCCCTGTCCATCCATGCCCTTTCCCACCACAGCTTGGAAGACATGCAGTTATTGGATGAATCAGGGATCAGCATATTGGACCAGTCAGTGATAAAAAAAGTTCCCATTTCATCAAAGAACAATAGCAGCATGATGTCCGCCCTATCCATGAATAAAGAAAGCCTTATCGGTGGTGTATCTAATCCAAACGAAGTTTTCTGCTCAGTCCCTGGACGTCTGTCCCTCTTGAGTTCCACTTCAAAGTACAAAGTGACAGTGGGGAGAGGTTCAAAGGCGTCTTTCACCTCCGGAGTGTCTCATTGCATCTCTTTCCTCGGAGGCCGTTCTCAGGAAGGGCAAAGTCAAAAGAAAGGGTGGGACGTTTGTCCTTCCAAAAACGGTTTA
Full Trace Sequence: TCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGGTACACGCGTACTCTGCCATGGATCGCTCTGAAGTTTTGAATGGAGCAGCCAGCGGCGGCCGACTCTCCCAGCTGTCATCTCTCAACCAAGGGCCCTACAGCTCGGCCCCTCCACTGTGCCACACGCCGGCGTCCGACTTTCAGCCCCCCTACTTCCCTCCCCCGTACCCCCAACCTCCTTTATCTTACTCCCAGAGCCAGGAGTCCGGATACCCACACCTCGGCGACCCCTACAGCAGCATCAACTCCATCCACCACCAGCACCAGCAGCCCTCCTGGCACACCCCGCGGAGCCGCCCGGAGGAGGCAGGACTCCTCTCCCAAACTCACAGGGGACTCAGTCTGGACCCACGGAGAGACTACGGGGGAATGTCCCGCCTCATCCCTGGTTTGACAGACGGGGGTCACAGCCTGGCAGACAGCTCCCTGTCCATCCATGCCCTTTCCCACCACAGCTTGGAAGACATGCAGTTATTGGATGAATCAGGGATCAGCATATTGGACCAGTCAGTGATAAAAAAAGTTCCCATTTCATCAAAGAACAATAGCAGCATGATGTCCGCCCTATCCATGAATAAAGAAAGCCTTATCGGTGGTGTATCTAATCCAAACGAAGTTTTCTGCTCAGTCCCTGGACGTCTGTCCCTCTTGAGTTCCACTTCAAAGTACAAAGTGACAGTGGGGAGAGGTTCAAAGGCGTCTTTCACCTCCGGAGTGTCTCATTGCATCTCTTTCCTCGGAGGCCGTTCTCAGGAAGGGCAAAGTCAAAAGAAAGGGTGGGACGTTTGTCCTTCCAAAAACGGTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGTACACGCGTACT

Sequences - 3ʹ (reverse) EST

Accession: JZ837913
dbEST ID: 79655615
Trimmed Sequence: TTTCCGATGCTTAATGTCCTTTTCTGATTTGGATTCTGCTGCAGAGTGTCCGTTTCCTGTGCTACTCATGAAGATCTTGTCCATTCCTTTAAGAGATTCCAGGAGATAGTTCTGGAAAGCTGTGAGGGCAGCACATATGGCTGGCCCACCAAAGCCATGTGTGATTAGGCTGAAGTGCGTCAGGCAGCTCTGAACACCAGGCTCCAGTATGAGGGATGGACGGCTGTTCCCAAGAGGGGAGCGATCCTGGGCTAACAAGTCAGCAAACTCCTTGCAGATCTGCTTTGTAGCAAGCAACATATTTTTCCTTGCATGGAGCTCTGTGGGATCAGAGTGCTGCCGGCAGAGGTATTCAGCAGCAGCTTTAGCTGGGAACTCGGTTTCACAGACATAGCCGAAATCCCGTGCAAGATGTACAGCCTCACCTTCCACCAGTGATGTCAACAGGGTCACGTTTGCTGCTTTGCGCCTCCCCGCTGGTAAATTCAGTCCAATCTTTTCTAACCGTTCTCGAAGACAACGTCCACCATTCTTTGACTTTGCCCTCCTGAGAACGCCTCCGAGAAGAGATGCATTGAGACACTCCCGGAAGTGAAAGACGCCTTTGAACCTCTCCCACTGTCACTTTGTACTTTGAAGTGGAACTCAAGAAGGGACAAACGTCCCGGGACTGAGCAAAAAAACTTCCTTTGGAATTAAAAACCCCACCCAATAAGGCCTTTCTTTAATCAAGGGAATAGGGCCGGAAATCCAGGCCCGGCCTTTGGGTT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGAGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCCGATGCTTAATGTCCTTTTCTGATTTGGATTCTGCTGCAGAGTGTCCGTTTCCTGTGCTACTCATGAAGATCTTGTCCATTCCTTTAAGAGATTCCAGGAGATAGTTCTGGAAAGCTGTGAGGGCAGCACATATGGCTGGCCCACCAAAGCCATGTGTGATTAGGCTGAAGTGCGTCAGGCAGCTCTGAACACCAGGCTCCAGTATGAGGGATGGACGGCTGTTCCCAAGAGGGGAGCGATCCTGGGCTAACAAGTCAGCAAACTCCTTGCAGATCTGCTTTGTAGCAAGCAACATATTTTTCCTTGCATGGAGCTCTGTGGGATCAGAGTGCTGCCGGCAGAGGTATTCAGCAGCAGCTTTAGCTGGGAACTCGGTTTCACAGACATAGCCGAAATCCCGTGCAAGATGTACAGCCTCACCTTCCACCAGTGATGTCAACAGGGTCACGTTTGCTGCTTTGCGCCTCCCCGCTGGTAAATTCAGTCCAATCTTTTCTAACCGTTCTCGAAGACAACGTCCACCATTCTTTGACTTTGCCCTCCTGAGAACGCCTCCGAGAAGAGATGCATTGAGACACTCCCGGAAGTGAAAGACGCCTTTGAACCTCTCCCACTGTCACTTTGTACTTTGAAGTGGAACTCAAGAAGGGACAAACGTCCCGGGACTGAGCAAAAAAACTTCCTTTGGAATTAAAAACCCCACCCAATAAGGCCTTTCTTTAATCAAGGGAATAGGGCCGGAAATCCAGGCCCGGCCTTTGGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCCGATGCTTAATGTCCTTTTC