ORFeome > tfdp2 ORF1 – XORFeome v1.0

tfdp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tfdp2
Gene ID: 1000265
Gene Page ID: 1000259
ORF Xenbase ID: 17300583

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124860
Original XGC clone length: 1131

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ838182
dbEST ID: 79655884
Trimmed Sequence: ATGATTATAAGCACTCCCCACAGACTGAGCGTGGCAGGAGATCTTCTGATTGGGAGTTCATACACTGCCAATACTTCAGCTATGGTCACCCAGAGCCACATCACAGAGGCCACCACCTGGATTCCAGGGGACAGGAAACGTGCTCGAGAATTTATAGAATCTGACTTTTCGGAAAGTAAAAGAAGTAAAAGAGGAGAGAAGAGTGGAAAGGGCCTGAGGCATTTCTCCATGAAAGTGTGTGAGAAGGTTCAAACCAAAGGGACCACGTCTTATAACGAAGTAGCAGATGAGCTGGTGGCCGAGTTGGCTAACTCTGCGGGTCACTTGCCCACTGATTCTGCCTATGACCAAAAAAACATCAGGAGGAGGGTATATGATGCCCTGAATGTACTGATGGCAATGAATATTATTTCCAAAGAGAAGAAAGAAATCAAGTGGATCGGGTTACCCTCTAACTCAGTCCAGGAGTGTGAAACTTTGGAGATAGAGAAACAAAGAAGAATAGAACGCATTANAGAGAAGAGCGCCCAGCTGCAAGAGCTGCTCCTGCAGCAAATTGCTTTTAAGCACCTTGTTCAGAGGAATAAACAAAATGAACCACAAAGCCGTTGCCTCCCTGCTGGAAATGCAACCATTAG
Full Trace Sequence: AGGAGAAGAGGTTTAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTATAAGCACTCCCCACAGACTGAGCGTGGCAGGAGATCTTCTGATTGGGAGTTCATACACTGCCAATACTTCAGCTATGGTCACCCAGAGCCACATCACAGAGGCCACCACCTGGATTCCAGGGGACAGGAAACGTGCTCGAGAATTTATAGAATCTGACTTTTCGGAAAGTAAAAGAAGTAAAAGAGGAGAGAAGAGTGGAAAGGGCCTGAGGCATTTCTCCATGAAAGTGTGTGAGAAGGTTCAAACCAAAGGGACCACGTCTTATAACGAAGTAGCAGATGAGCTGGTGGCCGAGTTGGCTAACTCTGCGGGTCACTTGCCCACTGATTCTGCCTATGACCAAAAAAACATCAGGAGGAGGGTATATGATGCCCTGAATGTACTGATGGCAATGAATATTATTTCCAAAGAGAAGAAAGAAATCAAGTGGATCGGGTTACCCTCTAACTCAGTCCAGGAGTGTGAAACTTTGGAGATAGAGAAACAAAGAAGAATAGAACGCATTANAGAGAAGAGCGCCCAGCTGCAAGAGCTGCTCCTGCAGCAAATTGCTTTTAAGCACCTTGTTCAGAGGAATAAACAAAATGAACCACAAAGCCGTTGCCTCCCTGCTGGAAATGCAACCATTAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTATAAGCACTCCCCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838181
dbEST ID: 79655883
Trimmed Sequence: CTCCATGGAGGATGAGTCATCTTCTTCATCTTCATCATCATCAAACCAACAGGGGGTCTGCCCTCGCGACTCTGTGTAGTGTGACGTTCCTGAGCTTGAATGGTGACTACTGGTGGTTAGGGACACCTCGGAGTCAAAGTATAAACCCGAGGTTAAGCTTGCTTGGGCGTTTGTGGTAGTGCAAGCTGTATTCCCCGAAGAAGGAATAGTCTGGGAATTAAAACTCTGATCTGCCCATGAGCTTCCTGTAGCCATTTCTGTGACGTATCCTTCAAGGGCTCTGGGTACAAAGGACTTGGCGAGCCTTAGGTTCTCTGATGTGCACTTTCCAGACTCTAGCCCAAATGACATTCCCATTCTTTTCAAGACTTCAATGTCATCATGGATTTCAAAAGCATTGTCAAAATTAAAAAGGTATTCAAACTTGTCACTGGATATGCTGCAGTCAATAACAGTCCTTTTACTGGTGTTTACGATGATAAAGGGTAATTTAATGGTGGAATTTCCATCAGGGAGGCAACGGCTTTGCTGCTCATTTTGTTTATTCCTCTGAACAAGGTGCTTAAAAGCCAATTGCTGCAAGAGCAGCTCCTGCAACTGGGCGCTCTTCTCTTTAATGCATTCTATTTCTTCTTTTTTTCTCTATCTCCAAAGTTTCACACTCCTTGAACTAAGTTAGAAGGGAACCCCAAATCCACTTGAATTTTCTTCGTTCTCTTTTGAAAAAAAAAGAAATCAATTTGCGAGTCAAGGAAAGTGT
Full Trace Sequence: GAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCATGGAGGATGAGTCATCTTCTTCATCTTCATCATCATCAAACCAACAGGGGGTCTGCCCTCGCGACTCTGTGTAGTGTGACGTTCCTGAGCTTGAATGGTGACTACTGGTGGTTAGGGACACCTCGGAGTCAAAGTATAAACCCGAGGTTAAGCTTGCTTGGGCGTTTGTGGTAGTGCAAGCTGTATTCCCCGAAGAAGGAATAGTCTGGGAATTAAAACTCTGATCTGCCCATGAGCTTCCTGTAGCCATTTCTGTGACGTATCCTTCAAGGGCTCTGGGTACAAAGGACTTGGCGAGCCTTAGGTTCTCTGATGTGCACTTTCCAGACTCTAGCCCAAATGACATTCCCATTCTTTTCAAGACTTCAATGTCATCATGGATTTCAAAAGCATTGTCAAAATTAAAAAGGTATTCAAACTTGTCACTGGATATGCTGCAGTCAATAACAGTCCTTTTACTGGTGTTTACGATGATAAAGGGTAATTTAATGGTGGAATTTCCATCAGGGAGGCAACGGCTTTGCTGCTCATTTTGTTTATTCCTCTGAACAAGGTGCTTAAAAGCCAATTGCTGCAAGAGCAGCTCCTGCAACTGGGCGCTCTTCTCTTTAATGCATTCTATTTCTTCTTTTTTTCTCTATCTCCAAAGTTTCACACTCCTTGAACTAAGTTAGAAGGGAACCCCAAATCCACTTGAATTTTCTTCGTTCTCTTTTGAAAAAAAAAGAAATCAATTTGCGAGTCAAGGAAAGTGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCATGGAGGATGAGTCATCTT