ORFeome > tfpi2 ORF1 – XORFeome v1.0

tfpi2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tfpi2
Gene ID: 6255487
Gene Page ID: 1002089
ORF Xenbase ID: 17300613

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC055972
Original XGC clone length: 675

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ824550
dbEST ID: 79642252
Trimmed Sequence: ATGCATACCTCCTCCTTCCAGGCTCTGATGGCAGCCAGCCTTCTCATTCAGGTCTTTGGCGCACCCATGCAAGGTAACACCACGGTTTGCTTGTTGCCCCTTGACGAGGGCCCCTGTAAAGCTCTTATCCCACATTATTACTATGATCGATATACGCAGACTTGCCAAGAATTTTTTTATGGGGGTTGTGATGGAAACGCAAATAATTTTGTGTCTATGGAGGACTGTGAAAAATTTTGCTGGAAGATCAAAAAGGTTCCCAAGGCCTGCAGGATGGTTCCTGATGAAGGACCTTGCCGCGGCTACATAAAGAGATACGCTTACAACATGAAGACAATGAGGTGTGAGCAGTTTATATACGGCGGCTGCTACGGCAATGACAACAACTTCCAAGATAAAGACTCTTGTATAAACTTCTGTGCCCCAAGGCGAGATGCTCCCAGTTTCTGTTATAGCCCAAAGGATGAGGGATCATGTTCTGCTTCTGTTACTCGCTATTATTTTAACATTGAGAGCAAAGCCTGTGAAGAGTTTGTATATACTGGGGTGTGGTGGAAACTCAAACAACTTTATCAAAGTGGAGGATTGCGACAGTGTGTGCAAGAAAGGTACTAAAAGGCCAAGAAATCAGAATCCCAAAATACCTCGCATTCGCAGGCCAGGNATACAGTCATT
Full Trace Sequence: AATTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATACCTCCTCCTTCCAGGCTCTGATGGCAGCCAGCCTTCTCATTCAGGTCTTTGGCGCACCCATGCAAGGTAACACCACGGTTTGCTTGTTGCCCCTTGACGAGGGCCCCTGTAAAGCTCTTATCCCACATTATTACTATGATCGATATACGCAGACTTGCCAAGAATTTTTTTATGGGGGTTGTGATGGAAACGCAAATAATTTTGTGTCTATGGAGGACTGTGAAAAATTTTGCTGGAAGATCAAAAAGGTTCCCAAGGCCTGCAGGATGGTTCCTGATGAAGGACCTTGCCGCGGCTACATAAAGAGATACGCTTACAACATGAAGACAATGAGGTGTGAGCAGTTTATATACGGCGGCTGCTACGGCAATGACAACAACTTCCAAGATAAAGACTCTTGTATAAACTTCTGTGCCCCAAGGCGAGATGCTCCCAGTTTCTGTTATAGCCCAAAGGATGAGGGATCATGTTCTGCTTCTGTTACTCGCTATTATTTTAACATTGAGAGCAAAGCCTGTGAAGAGTTTGTATATACTGGGGTGTGGTGGAAACTCAAACAACTTTATCAAAGTGGAGGATTGCGACAGTGTGTGCAAGAAAGGTACTAAAAGGCCAAGAAATCAGAATCCCAAAATACCTCGCATTCGCAGGCCAGGNATACAGTCATTGCCNACTTTCTTGTACNAAGTTGGCATTTATAGAAAGCATTGCTTATCAATTTGNTTGCACGAACANGTCACTATCAGTCAAATAAAATCCATATTTTGCCATCCAGCTGAATCCCTCNAAAATGGATCGTTTAATAGTGTCAAGCGTTCTGCTGNGCCCCCGCCCACACTCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATACCTCCTCCTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ829902
dbEST ID: 79647604
Trimmed Sequence: TGACTGTATCCTTGGCCTGCGAATGCGAGGTATTTTGGGATTCTGATTTCTTGGCCTTTTAGTACCTTTCTTGCACACACTGTCGCAATCCTCCACTTTGATAAAGTTGTTTGAGTTTCCACCACACCCAGTATATACAAACTCTTCACAGGCTTTGCTCTCAATGTTAAAATAATAGCGAGTAACAGAAGCAGAACATGATCCCTCATCCTTTGGGCTATAACAGAAACTGGGAGCATCTCGCCTTGGGGCACAGAAGTTTATACAAGAGTCTTTATCTTGGAAGTTGTTGTCATTGCCGTAGCAGCCGCCGTATATAAACTGCTCACACCTCATTGTCTTCATGTTGTAAGCGTATCTCTTTATGTAGCCGCGGCAAGGTCCTTCATCAGGAACCATCCTGCAGGCCTTGGGAACCTTTTTGATCTTCCAGCAAAATTTTTCACAGTCCTCCATAGACACAAAATTATTTGCGTTTCCATCACAACCCCCATAAAAAAATTCTTGGCAAGTCTGCGTATATCGATAATAGTAATAATGTGGGATAAGAGCTTTACAGGGGCCCTCGTCAAGGGGCAACAAGCAAACCGTGGTGTTACCTTGCATGGGTGCGCCAAAGACCTGAATGAGAAGGCTGGCTGCCATCAGAGGCTGGAAGGAGGAAGGATGCATGGGGGCCAACTTTTTTTGTACCAGAGTTGGCATTAATAAAAAAGCATTGGCTTCATCAATTTTGTTGTGCAACCAAAAAGG
Full Trace Sequence: CCGGGAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGACTGTATCCTTGGCCTGCGAATGCGAGGTATTTTGGGATTCTGATTTCTTGGCCTTTTAGTACCTTTCTTGCACACACTGTCGCAATCCTCCACTTTGATAAAGTTGTTTGAGTTTCCACCACACCCAGTATATACAAACTCTTCACAGGCTTTGCTCTCAATGTTAAAATAATAGCGAGTAACAGAAGCAGAACATGATCCCTCATCCTTTGGGCTATAACAGAAACTGGGAGCATCTCGCCTTGGGGCACAGAAGTTTATACAAGAGTCTTTATCTTGGAAGTTGTTGTCATTGCCGTAGCAGCCGCCGTATATAAACTGCTCACACCTCATTGTCTTCATGTTGTAAGCGTATCTCTTTATGTAGCCGCGGCAAGGTCCTTCATCAGGAACCATCCTGCAGGCCTTGGGAACCTTTTTGATCTTCCAGCAAAATTTTTCACAGTCCTCCATAGACACAAAATTATTTGCGTTTCCATCACAACCCCCATAAAAAAATTCTTGGCAAGTCTGCGTATATCGATAATAGTAATAATGTGGGATAAGAGCTTTACAGGGGCCCTCGTCAAGGGGCAACAAGCAAACCGTGGTGTTACCTTGCATGGGTGCGCCAAAGACCTGAATGAGAAGGCTGGCTGCCATCAGAGGCTGGAAGGAGGAAGGATGCATGGGGGCCAACTTTTTTTGTACCAGAGTTGGCATTAATAAAAAAGCATTGGCTTCATCAATTTTGTTGTGCAACCAAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGACTGTATCCTTGGCCT