ORFeome > tfpt ORF1 – XORFeome v1.0

tfpt ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tfpt
Gene ID: 6252251
Gene Page ID: 956156
ORF Xenbase ID: 17300619

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122511
Original XGC clone length: 759

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ838809
dbEST ID: 79656511
Trimmed Sequence: ATGGCTGGAGTGGGCTTTGAGGAGTTCTCTGTACCTCCTGGGTCTGAACTTGCTTGGCCACCTCTATTTGGGGGAAATATTCTGGAGAGTGAGTTAGAAACAGAGGTGGAATTTGTGGATGGAGGCCTTACCGGAGATAACCTTCAGGATGAAGAGGAAGAAGAAGCCCAGCAGCGTCAGCGTGAGCTGCACAGAAGGAAGTTTATTACATTGAGACGGCGCTGCAAAGAAATATAACTGGTAAACGAGAGAATTCTTAACAGGCTTCACCACGTGGAAAAGATAACACGAAGGCTGAAACACAAAAAGAGATGTTTGATGACAGTCTTGGATGCCTATGAGGATGATTACACAAAGAGCCATCTCACTTTTTTGTTATAAAATGAAGGGACCCACCCACACAACTCCCCTGCGCATGCGAACTCTGATAGAAAGCCTCGCGCGGAATGAGGAGATGTCGGTTGGTCCCTGTGGCTCGTCTAGGGCACCCCCTTGTTCGGGAAAGTAATTATCCCTCCCCCATACGTCTCTTTACGAGAGTGACGGGCTCGCTGAGTAATAAGGATAAACCTTAACGGAAAAAGAAGAAAAAATAATAAAGAAAAGAACAGGAGCGGGGCTGTTTCTTGCTTTGGGAATCCATCTGCTGTTTGGGGGGGGGAGGAGGGAGGAGGAAGAAGAGCGGTTGTTGGGGGGAGGTGAAGAAAGAGATAGTGTCGATCCTTGTTAGGGTGCGTCGAGGCCCAGCCGTGCCTCAAACGACCCATCCTCATATGACATGAAGAGTATTTCGTGGGACCTGACGGCCGTGAGGATGTAGGCAGTGATGATGCACAATGTGGTCAGATG
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGAGTGGGCTTTGAGGAGTTCTCTGTACCTCCTGGGTCTGAACTTGCTTGGCCACCTCTATTTGGGGGAAATATTCTGGAGAGTGAGTTAGAAACAGAGGTGGAATTTGTGGATGGAGGCCTTACCGGAGATAACCTTCAGGATGAAGAGGAAGAAGAAGCCCAGCAGCGTCAGCGTGAGCTGCACAGAAGGAAGTTTATTACATTGAGACGGCGCTGCAAAGAAATATAACTGGTAAACGAGAGAATTCTTAACAGGCTTCACCACGTGGAAAAGATAACACGAAGGCTGAAACACAAAAAGAGATGTTTGATGACAGTCTTGGATGCCTATGAGGATGATTACACAAAGAGCCATCTCACTTTTTTGTTATAAAATGAAGGGACCCACCCACACAACTCCCCTGCGCATGCGAACTCTGATAGAAAGCCTCGCGCGGAATGAGGAGATGTCGGTTGGTCCCTGTGGCTCGTCTAGGGCACCCCCTTGTTCGGGAAAGTAATTATCCCTCCCCCATACGTCTCTTTACGAGAGTGACGGGCTCGCTGAGTAATAAGGATAAACCTTAACGGAAAAAGAAGAAAAAATAATAAAGAAAAGAACAGGAGCGGGGCTGTTTCTTGCTTTGGGAATCCATCTGCTGTTTGGGGGGGGGAGGAGGGAGGAGGAAGAAGAGCGGTTGTTGGGGGGAGGTGAAGAAAGAGATAGTGTCGATCCTTGTTAGGGTGCGTCGAGGCCCAGCCGTGCCTCAAACGACCCATCCTCATATGACATGAAGAGTATTTCGTGGGACCTGACGGCCGTGAGGATGTAGGCAGTGATGATGCACAATGTGGTCAGATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGAGTGGGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838808
dbEST ID: 79656510
Trimmed Sequence: ATCAAAATCTGGGCTGGAAAACTTTGGATATTGTAGGATCTTGTCTCGTGGGCTGAGAACGCGCCAGCTCAGAGGCAGCTCCTCATCTCCTTCACACAGGTAATCCTCTTCAATCTTCACCTGAACCAGAAGAGGTTCTGATGGAAGAAGAGATGGGGTCAGTCTTCTTCCATTATGGTCTTTCTCTTCCTTGAGCTTTTTCCTCTTTTTAGCTGGTGGCCCCTCTGTCTGTGATGGACTTAGAGGGCTATTAGTTTCCAGACCAAGGGGCTGCCCAGATGAGCAAACAGGAGTAACAGACATCTCCTCATTCGCCGGAGGTTCATTTTCAGAGTTCCCATGGGCAGGGGAGTTGTGTGGGTGGGTCCCTTCATCCTCTAACAAAAAAGTGAGATGGCTCTTTCTGTAATCATCCTCATAGGCGTCCAAGACCGTCATCAAACATCTCCTTTTGTGTTTGAGCCTTCGTGTTATCTTCTTCACCTGGTGAAGGCCGGTTTAGAATTCTCTCGTTTTATGGTTCTATTTCTTTGCAGCGCCGTCCCAATGTAGAGAAGGTTCCTTCTGTTCAGCGACAGCTGACGCTGGCTGGCTTCTTGTGTCTCTTAATCCTGAAAGTTATCTCGCGGGAAAGGCTCCAGTCGGGAAATTCCACTTCGGTTTTCTTCTTCTTTTCGCCTAAATTGTTTCCCTCTAATAATAGGGTGGCCCAAGGAGGGGTGGGAACCGGGCTCATTTACAAAAAAAGCACCAACAAACCCCACCCCACAACCCA
Full Trace Sequence: GAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCAAAATCTGGGCTGGAAAACTTTGGATATTGTAGGATCTTGTCTCGTGGGCTGAGAACGCGCCAGCTCAGAGGCAGCTCCTCATCTCCTTCACACAGGTAATCCTCTTCAATCTTCACCTGAACCAGAAGAGGTTCTGATGGAAGAAGAGATGGGGTCAGTCTTCTTCCATTATGGTCTTTCTCTTCCTTGAGCTTTTTCCTCTTTTTAGCTGGTGGCCCCTCTGTCTGTGATGGACTTAGAGGGCTATTAGTTTCCAGACCAAGGGGCTGCCCAGATGAGCAAACAGGAGTAACAGACATCTCCTCATTCGCCGGAGGTTCATTTTCAGAGTTCCCATGGGCAGGGGAGTTGTGTGGGTGGGTCCCTTCATCCTCTAACAAAAAAGTGAGATGGCTCTTTCTGTAATCATCCTCATAGGCGTCCAAGACCGTCATCAAACATCTCCTTTTGTGTTTGAGCCTTCGTGTTATCTTCTTCACCTGGTGAAGGCCGGTTTAGAATTCTCTCGTTTTATGGTTCTATTTCTTTGCAGCGCCGTCCCAATGTAGAGAAGGTTCCTTCTGTTCAGCGACAGCTGACGCTGGCTGGCTTCTTGTGTCTCTTAATCCTGAAAGTTATCTCGCGGGAAAGGCTCCAGTCGGGAAATTCCACTTCGGTTTTCTTCTTCTTTTCGCCTAAATTGTTTCCCTCTAATAATAGGGTGGCCCAAGGAGGGGTGGGAACCGGGCTCATTTACAAAAAAAGCACCAACAAACCCCACCCCACAACCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCAAAATCTGGGCTGGAAAACT