ORFeome > tgfb1 ORF1 – XORFeome v1.0

tgfb1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tgfb1
Gene ID: 865765
Gene Page ID: 488110
ORF Xenbase ID: 17300637

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129720
Original XGC clone length: 1149

Human orthology & disease relationships

NCBI Entrez ID: 7040
Ensembl gene IDs: ENSG00000105329
Directly associated (OMIM) disease MIM numbers: 131300,219700
Indirectly associated (Lage, et al.) disease MIM numbers: 131300,132400,154705,177170,600376,609192,610048

Library Location

Plate ID: GDExl11092
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ838962
dbEST ID: 79656664
Trimmed Sequence: ATGGAGGTTCTGTGGATGCTGCTGGTGCTATTGGTCCTGCATCTTTCCAGTTTAGCTATGTCCTTGTCTACCTGTAAGGCTGTGGATATGGAAGAAGTCAGGAAGAGGAGAATTGAAGCCATCAGGGGCCAAATTCTCAGCAAGCTAAAACTGGACAAAACACCAGATGTAGACAGCGAGAAGATGACAGTGCCCAGTGAAGCCATCTTCCTTTACAATAGCACCTTGGAGGTGATCAGAGAAAAAGCAACCAGAGAAGAAGAACATGTAGGGCATGATCAGAACATACAGGACTATTATGCAAAACAAGTTTACCGATTTGAAAGCATAACCGAACTGGAAGACCATGAATTTAAGTTTAAATTTAATGCTTCGCATGTGAGGGAGAATGTAGGTATGAACTCTCTTCTGCACCATGCTGAGCTGCGCATGTACAAGAAGCAGACAGATAAAAACATGGATCAAAGGATGGAACTATTCTGGAAATACCAGGAAAATGGGACCACTCACTCAAGATACCTGGAGAGCAAGTACATTACTCCAGTAACAGATGATGAGTGGATGTCATTTGATGTTACAAAGACTGTGAATGAATGGCTGAAACGTGCAGAGGAGNATGAACAATTCGGGTTGCAGCCTGCCTGCAAATGTCCCACCCCACAGGCCCAAGATATAAACATAGAAAGATTTCCCTGCTTACGTGGAGACTGGGCGAGGTTTGAGTTCCAAAGAAAACACAAAACCCTAACCGAATGATCCCTTCCAATGCCGCCTGACCTTAATGTAACAATTTTCCAACCTCACCGAAAAAAACCAAG
Full Trace Sequence: CGGGGGCCCAATAANTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGTTCTGTGGATGCTGCTGGTGCTATTGGTCCTGCATCTTTCCAGTTTAGCTATGTCCTTGTCTACCTGTAAGGCTGTGGATATGGAAGAAGTCAGGAAGAGGAGAATTGAAGCCATCAGGGGCCAAATTCTCAGCAAGCTAAAACTGGACAAAACACCAGATGTAGACAGCGAGAAGATGACAGTGCCCAGTGAAGCCATCTTCCTTTACAATAGCACCTTGGAGGTGATCAGAGAAAAAGCAACCAGAGAAGAAGAACATGTAGGGCATGATCAGAACATACAGGACTATTATGCAAAACAAGTTTACCGATTTGAAAGCATAACCGAACTGGAAGACCATGAATTTAAGTTTAAATTTAATGCTTCGCATGTGAGGGAGAATGTAGGTATGAACTCTCTTCTGCACCATGCTGAGCTGCGCATGTACAAGAAGCAGACAGATAAAAACATGGATCAAAGGATGGAACTATTCTGGAAATACCAGGAAAATGGGACCACTCACTCAAGATACCTGGAGAGCAAGTACATTACTCCAGTAACAGATGATGAGTGGATGTCATTTGATGTTACAAAGACTGTGAATGAATGGCTGAAACGTGCAGAGGAGNATGAACAATTCGGGTTGCAGCCTGCCTGCAAATGTCCCACCCCACAGGCCCAAGATATAAACATAGAAAGATTTCCCTGCTTACGTGGAGACTGGGCGAGGTTTGAGTTCCAAAGAAAACACAAAACCCTAACCGAATGATCCCTTCCAATGCCGCCTGACCTTAATGTAACAATTTTCCAACCTCACCGAAAAAAACCAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGTTCTGTGGATG

Sequences - 3ʹ (reverse) EST

Accession: JZ838961
dbEST ID: 79656663
Trimmed Sequence: GCTGCAGTTGCAAGACCTTACCACCATATTAGAGAGCTGCTCTACTTTAGCAGTGCGGCCAACATAATAAATGATTGGCAGTGGCTCCAAGACATCAGGAACACAGCAGGGAGATATAGATGCACCGGGATTGTTCTGATTATAAAGTGATAGCACCTTGCTGTACTGAGTATCCATGCTCCAGATGTAAGGACAATTTCCTAAACAATAATTTGCTTCATATCCCTTAGGCTCATGGATCCACTTCCAGCCTAGATCCTTCCGAAAATTTATGTAAAGAGGTTTCACACAGCAGTTTGGCCCATTGTTCCCAAAGCAATACTCCTGTCCAACCCCTCGCTTTTTCCGTGAGCTTGTAACTGTGTCAATACGCTCAGCTGGCATCGAAGTGATCATCAGGTAGGGTTTCGTGTTTTCTTTGGAACTCAAACTCGCCAAGTCTCCACGTAAAGCAGGAAATCCTTCTATGTCTATATCTTTGGCCTGTGGGGTGGGACATTTGCAGGCAGGCTGCAACCCGAATTGTTCATTTTCCTCTGCACGTTTCAGCCATTCATTCACAGTCCTTGTAACATCAAATGGACTCCACTCATCATCTGTTACTGGAGTTATGTACTTTGCTCGTCAGGTATCCTGAGTGAATGGTCCCATTTTCCTGGTATTTCCAAAATAATTTCCTTCCTTTTAATCCAGGTTTTTTATCTGTCTTGCTTTCTTGTACATTGCGCCACCTTGGCCCGGGGGGGCAAAAAAAAAAGTTTCA
Full Trace Sequence: GGGGAAATGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGCAGTTGCAAGACCTTACCACCATATTAGAGAGCTGCTCTACTTTAGCAGTGCGGCCAACATAATAAATGATTGGCAGTGGCTCCAAGACATCAGGAACACAGCAGGGAGATATAGATGCACCGGGATTGTTCTGATTATAAAGTGATAGCACCTTGCTGTACTGAGTATCCATGCTCCAGATGTAAGGACAATTTCCTAAACAATAATTTGCTTCATATCCCTTAGGCTCATGGATCCACTTCCAGCCTAGATCCTTCCGAAAATTTATGTAAAGAGGTTTCACACAGCAGTTTGGCCCATTGTTCCCAAAGCAATACTCCTGTCCAACCCCTCGCTTTTTCCGTGAGCTTGTAACTGTGTCAATACGCTCAGCTGGCATCGAAGTGATCATCAGGTAGGGTTTCGTGTTTTCTTTGGAACTCAAACTCGCCAAGTCTCCACGTAAAGCAGGAAATCCTTCTATGTCTATATCTTTGGCCTGTGGGGTGGGACATTTGCAGGCAGGCTGCAACCCGAATTGTTCATTTTCCTCTGCACGTTTCAGCCATTCATTCACAGTCCTTGTAACATCAAATGGACTCCACTCATCATCTGTTACTGGAGTTATGTACTTTGCTCGTCAGGTATCCTGAGTGAATGGTCCCATTTTCCTGGTATTTCCAAAATAATTTCCTTCCTTTTAATCCAGGTTTTTTATCTGTCTTGCTTTCTTGTACATTGCGCCACCTTGGCCCGGGGGGGCAAAAAAAAAAGTTTCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGCAGTTGCAAGACC