ORFeome > tgfb1i1 ORF1 – XORFeome v1.0

tgfb1i1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tgfb1i1
Gene ID: 866238
Gene Page ID: 493248
ORF Xenbase ID: 17300643

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC125983
Original XGC clone length: 1092

Human orthology & disease relationships

NCBI Entrez ID: 7041
Ensembl gene IDs: ENSG00000140682
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 300068,308370,312300,313200

Library Location

Plate ID: GDExl11087
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ838116
dbEST ID: 79655818
Trimmed Sequence: ATGGCTTCTCTCTCTGATTTCCACAAGCAGAACACGGTATCACAAGAAGTGGAGGCTCCTGGTGCTTATAAAGGCTCTGAAGAAGTTTCAAGACCTGGAGATACAGAAGACCTATCAAGCCCAAGAAGCACAGCTTGTGTTCCTAAAGATTTGGAGGACGCACCAACTCCTAAAAGTTTCAAGGTGGTGTCCGCTCCTGGGCATTTGGAAGTCAAAACCAACCAAGTAAATTCTGATGAAGTGACAGCTTCCCGGGTGCCTGACTCTGTGTCTGGTTCCAAAGTTCCAGAAGCCACAAGTGTTCCAAGAAGTGATCTGGACTCCATGCTTGTAAAGCTACAGTCTGGGCTCAAGCAACAAGGCATTGAAACGTACAGCAAAGGATTATGTGAGAGCTGCCAACGACCAATAGCTGGGCAGGTGGTTACTGCTCTCGGACATACCTGGCACCCGGAGCACTTTGTGTGTGCCCACTGCCATACTCTGATCGGCACCACCAACTTCTTTGAAAAGGATGGGCGGCCATATTGCGAGAAAGACTACTTTATGCTCTACGCCCCGCGCTGTGCTCTATGTGAATTGCCCATTGTGCAGAACATGGTTACAGCACTTGGTTGCACTTGGCATCCAGAGCAATTTTGCTGTTAGGTCTGCAAAAACCCAAAAGGGGGAAAAGGGTTTCCATAGAAAGAATGGGGAGCAGTAATGCTCCAAAGAACAATTTTCCTCCTGTTTTGATCTGTGCGCGCCGGGCGGCACTTAAGGCCCGTGAAGAAAAAATTAAT
Full Trace Sequence: TCGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTCTCTCTGATTTCCACAAGCAGAACACGGTATCACAAGAAGTGGAGGCTCCTGGTGCTTATAAAGGCTCTGAAGAAGTTTCAAGACCTGGAGATACAGAAGACCTATCAAGCCCAAGAAGCACAGCTTGTGTTCCTAAAGATTTGGAGGACGCACCAACTCCTAAAAGTTTCAAGGTGGTGTCCGCTCCTGGGCATTTGGAAGTCAAAACCAACCAAGTAAATTCTGATGAAGTGACAGCTTCCCGGGTGCCTGACTCTGTGTCTGGTTCCAAAGTTCCAGAAGCCACAAGTGTTCCAAGAAGTGATCTGGACTCCATGCTTGTAAAGCTACAGTCTGGGCTCAAGCAACAAGGCATTGAAACGTACAGCAAAGGATTATGTGAGAGCTGCCAACGACCAATAGCTGGGCAGGTGGTTACTGCTCTCGGACATACCTGGCACCCGGAGCACTTTGTGTGTGCCCACTGCCATACTCTGATCGGCACCACCAACTTCTTTGAAAAGGATGGGCGGCCATATTGCGAGAAAGACTACTTTATGCTCTACGCCCCGCGCTGTGCTCTATGTGAATTGCCCATTGTGCAGAACATGGTTACAGCACTTGGTTGCACTTGGCATCCAGAGCAATTTTGCTGTTAGGTCTGCAAAAACCCAAAAGGGGGAAAAGGGTTTCCATAGAAAGAATGGGGAGCAGTAATGCTCCAAAGAACAATTTTCCTCCTGTTTTGATCTGTGCGCGCCGGGCGGCACTTAAGGCCCGTGAAGAAAAAATTAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTCTCTCTGATTTCCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838115
dbEST ID: 79655817
Trimmed Sequence: CCCATACAGCCGGGCGTAGCAAGCCTGGCAATAAGGTTTCTCATCGTGCTCCCGGAAGGTGCCCTTGTTCAGCTGTCGGAGGCAAAAAGTGCAATTCAAGTGTTGGGGGTGGAACTTCTTGCCCATTGCAGTCACACAGCGCCCTGTTATTGGCTGCTCACACCCAGCACACAGGGAGCCACGACGGGAGTGGTAATGAGTCTCACATAGAGGTAAGCCTTCATGTTCAAAGAAACTTCCATTGATGAATGGTGTGTGACACACATGGCACACAAAGCATTGTGGGTGCCACAAGCCTCCCAGGGCAGAGATATAACTCTCCTTCACGGCCTCAGTGCAGCCTGCGCAGACAGCTCCAAACAGACGGAAATAGTCGTCTGAGCAATACTGCTCCCCATCCTTCTCATGGAAACCCTCTTCCCCTATTGGTTTTTTGCAAACTTTACAGCAAAAATGCTCTGGATGCCAAGTGCAACCGAGTGCTGTAACCATGTTCTGCACAATGGGCAATTCACATAGAGCACAGCGCGGGGCGTAGAGCATAAAGTAGTCTTTCTCGCAATATGGCCGCGCGTCCCTTTCAAAAAAATTGATTGGTGCCAATCGAATATGGCAGTGGGCACACACGGAATTGCTCCGGGGGGCCGGGGGGTCCGGAAAAGAAGTAACAACCAGGCCCCACCTCTTGTTCGTTTGGGCGGGTCTCAGCATCACCCCTTCCCTGTTACATTTTTCAATGGCCCTTTTTTTTCTTTGTACCCCCCGGAGGTG
Full Trace Sequence: GGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCCATACAGCCGGGCGTAGCAAGCCTGGCAATAAGGTTTCTCATCGTGCTCCCGGAAGGTGCCCTTGTTCAGCTGTCGGAGGCAAAAAGTGCAATTCAAGTGTTGGGGGTGGAACTTCTTGCCCATTGCAGTCACACAGCGCCCTGTTATTGGCTGCTCACACCCAGCACACAGGGAGCCACGACGGGAGTGGTAATGAGTCTCACATAGAGGTAAGCCTTCATGTTCAAAGAAACTTCCATTGATGAATGGTGTGTGACACACATGGCACACAAAGCATTGTGGGTGCCACAAGCCTCCCAGGGCAGAGATATAACTCTCCTTCACGGCCTCAGTGCAGCCTGCGCAGACAGCTCCAAACAGACGGAAATAGTCGTCTGAGCAATACTGCTCCCCATCCTTCTCATGGAAACCCTCTTCCCCTATTGGTTTTTTGCAAACTTTACAGCAAAAATGCTCTGGATGCCAAGTGCAACCGAGTGCTGTAACCATGTTCTGCACAATGGGCAATTCACATAGAGCACAGCGCGGGGCGTAGAGCATAAAGTAGTCTTTCTCGCAATATGGCCGCGCGTCCCTTTCAAAAAAATTGATTGGTGCCAATCGAATATGGCAGTGGGCACACACGGAATTGCTCCGGGGGGCCGGGGGGTCCGGAAAAGAAGTAACAACCAGGCCCCACCTCTTGTTCGTTTGGGCGGGTCTCAGCATCACCCCTTCCCTGTTACATTTTTCAATGGCCCTTTTTTTTCTTTGTACCCCCCGGAGGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCCATACAGCCGGGCGTAG