ORFeome > thap1 ORF1 – XORFeome v1.0

thap1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: thap1
Gene ID: 1008764
Gene Page ID: 1008757
ORF Xenbase ID: 17300691

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084824
Original XGC clone length: 678

Human orthology & disease relationships

NCBI Entrez ID: 55145
Ensembl gene IDs: ENSG00000131931
Directly associated (OMIM) disease MIM numbers: 602629
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ840008
dbEST ID: 79657710
Trimmed Sequence: ATGGTGCAATCGTGCTCAGCTTACGGTTGCAAGAATCGCTACGATAAAGATAAACCCATCTCCTTTCACAAGTTTCCCCTGAAACGTCCGCTACTCTGCAAGAAATGGGAAGCTGCTGTACGAAGAGCTGAGTTTAAACCAACAAAGTACAGTAGCATTTGCTCTGACCATTTTTCAGCCGATTGTTTTAAAAGAGAGTGCAACAATAAACTTCTTAAGGATAATGCTGTGCCAACAATATTTGCACATATGGAAATAAAGAAAAAGAGTGGAAAAGCTGTTAAAAAAGAGCAACTGCCAGCTGAACCTGAACCAGTCCCTGCTGTTCCTGAAATAGACCCTGCTATTGGATTGCTACTCCCTCCTCTGTATACACCAAGTCACATTGCAGTCATTTGTGACCACAATTATACAGTGGAAGATACAGTTCATCAGAGGAGAAGGATACAGCAGCTTGAAGAACAAGTTGACAAACTCAGGAAAAAGCTGAAGATCGCTAACCAAAAGTGTCGAAGGCAGGAGCGGAGTCTGGAAAAACTAAAGAGAGAGGTTTCTGAATATAGGGAAGCCAAGGGATCTGGCTACGTTATCTTCCCTGGGTATTTATATGAAAGTCTTAAACGAAATGGATACAAAGAACTGACTCCCGAAATAACAAAAAAGGAAAATTTTCTGGTGGCCACTTTTTTGTACAAAGTTTGGATTATAAGAAAAACATGGCCTAATCCATTTGTTTGGGACGAACGGGGTCACTTATCAATCAAAAAAAAAAATAAATTATTGGCCCACCCCGCCTGAAAACCCCCCCTAAGAAAAAAAAACAAAAAAAAAA
Full Trace Sequence: CGTGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGCAATCGTGCTCAGCTTACGGTTGCAAGAATCGCTACGATAAAGATAAACCCATCTCCTTTCACAAGTTTCCCCTGAAACGTCCGCTACTCTGCAAGAAATGGGAAGCTGCTGTACGAAGAGCTGAGTTTAAACCAACAAAGTACAGTAGCATTTGCTCTGACCATTTTTCAGCCGATTGTTTTAAAAGAGAGTGCAACAATAAACTTCTTAAGGATAATGCTGTGCCAACAATATTTGCACATATGGAAATAAAGAAAAAGAGTGGAAAAGCTGTTAAAAAAGAGCAACTGCCAGCTGAACCTGAACCAGTCCCTGCTGTTCCTGAAATAGACCCTGCTATTGGATTGCTACTCCCTCCTCTGTATACACCAAGTCACATTGCAGTCATTTGTGACCACAATTATACAGTGGAAGATACAGTTCATCAGAGGAGAAGGATACAGCAGCTTGAAGAACAAGTTGACAAACTCAGGAAAAAGCTGAAGATCGCTAACCAAAAGTGTCGAAGGCAGGAGCGGAGTCTGGAAAAACTAAAGAGAGAGGTTTCTGAATATAGGGAAGCCAAGGGATCTGGCTACGTTATCTTCCCTGGGTATTTATATGAAAGTCTTAAACGAAATGGATACAAAGAACTGACTCCCGAAATAACAAAAAAGGAAAATTTTCTGGTGGCCACTTTTTTGTACAAAGTTTGGATTATAAGAAAAACATGGCCTAATCCATTTGTTTGGGACGAACGGGGTCACTTATCAATCAAAAAAAAAAATAAATTATTGGCCCACCCCGCCTGAAAACCCCCCCTAAGAAAAAAAAACAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCAATCGTGCTCAGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ840007
dbEST ID: 79657709
Trimmed Sequence: CAGAATAATTTCCTTATATGTTATTTCTGGAGTCAGTTCTTTGTATTCATTTTCGTTTAAGACTTCATAATAATTACCAGGGAAGATAACGTAGCCAGATCCCTTGGCTTCCCTATATTCAGAAACCTCTCTCTCTAGTTTTTCCAGACTCCGCTCCTGCCTTCGACACTTTTGGTTAGCGATCTTCAGCTTTTTCCTGAGTTTGTCAACTTGTTCTTCAAGCTGCTGTATCCTTCTCCTCTGATGAACTGTATCTTCCACTGTATAATTGTGGTCACAAATGACTGCAATGTGACTTGGTGTATACAGAGGAGGGAGTAGCAATCCAATAGCAGGGTCTATTTCAGGAACAGCAGGGACTGGTTCAGGTTCAGCTGGCAGTTGCTCTTTTTTAACAGCTTTTCCACTCTTTTTCTTTATTTCCATATGTGCAAATATTGTTGGCGCAGCATTATCCTTAAGAAGTTTATTGTTGCACTCTCTTTTAAAACAATCGGCTGAAGAATGGTCAGAGCAAATGCTGCTGTGCTTTGTTGGTTGTAACTCAAACCTTCCTCACACAGCTTTCCATTTCTTTCAGAGTAGCAGACGTTTCGGGGGGGACTTGTGAAGGGGGGATGGGTTGGTCGTTAGCTTAACGGATGCTGGCGAGCAGTAGGCTGAACACAAGTTGCACAGTGGGTGGCGGCTTGTTTTCTTCAAATTTGGGCTTTAATAAAGAAACATTCGCCCGGCGCATTTTGGTTGGCAAAAAAACAAA
Full Trace Sequence: AAACATGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGAATAATTTCCTTATATGTTATTTCTGGAGTCAGTTCTTTGTATTCATTTTCGTTTAAGACTTCATAATAATTACCAGGGAAGATAACGTAGCCAGATCCCTTGGCTTCCCTATATTCAGAAACCTCTCTCTCTAGTTTTTCCAGACTCCGCTCCTGCCTTCGACACTTTTGGTTAGCGATCTTCAGCTTTTTCCTGAGTTTGTCAACTTGTTCTTCAAGCTGCTGTATCCTTCTCCTCTGATGAACTGTATCTTCCACTGTATAATTGTGGTCACAAATGACTGCAATGTGACTTGGTGTATACAGAGGAGGGAGTAGCAATCCAATAGCAGGGTCTATTTCAGGAACAGCAGGGACTGGTTCAGGTTCAGCTGGCAGTTGCTCTTTTTTAACAGCTTTTCCACTCTTTTTCTTTATTTCCATATGTGCAAATATTGTTGGCGCAGCATTATCCTTAAGAAGTTTATTGTTGCACTCTCTTTTAAAACAATCGGCTGAAGAATGGTCAGAGCAAATGCTGCTGTGCTTTGTTGGTTGTAACTCAAACCTTCCTCACACAGCTTTCCATTTCTTTCAGAGTAGCAGACGTTTCGGGGGGGACTTGTGAAGGGGGGATGGGTTGGTCGTTAGCTTAACGGATGCTGGCGAGCAGTAGGCTGAACACAAGTTGCACAGTGGGTGGCGGCTTGTTTTCTTCAAATTTGGGCTTTAATAAAGAAACATTCGCCCGGCGCATTTTGGTTGGCAAAAAAACAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGAATAATTTCCTTATATGTTAT