ORFeome > thap5 ORF1 – XORFeome v1.0

thap5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: thap5
Gene ID: 6252802
Gene Page ID: 491347
ORF Xenbase ID: 17300697

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123138
Original XGC clone length: 1119

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ838050
dbEST ID: 79655752
Trimmed Sequence: ATGACTCGATACTGCGCAGCCACGCGTTGCAAGAACCGGGGAGGCCAGGCGGCTGTAATCCAGCGCAAAGTGTCCTTTTACCCGTTTCCTTTGCATGACAGGGGAAGGCTTCAAGAATGGCTTCGAAATATGAAACAGTACAAATTGTATCCCACCAAGCATCAGGTCTTGTGCAGTGATCATTTTACTGCTGATTCCTTCAATATAAGATGGGGTATTCAGTATCTGAAACCTAACGCTATCCCTACTTTATTCTCTTTCACAGAAAAAATCCAGGATATAGCTGAGTTGGAACTTACCATAAAGGAAGGGACGCAAGATGGTGTGAAGGTTGATACAGACACTGTGCCATCACAGGATTTTTGTCCAAATGTAACAAACAATTTGAGTCATGGTTTTGATACAGATGAATATGTTGACCCTGATGACAAACAGGTTTATCTGAAGAATACAATCGATGGAATTACAGTTTCACAAAATAAGACAAAAGACTTGTATGTTCCAAATTCTGAATATGAAATCCAGCCCCATTTGATAACACCCTCTAAATTCCGTCAGACCTCTGTGGAAAATATGATTGTTAGCTCTGTAACTGACTTAAACAGCCAAAGTAATCAGGTGTACTTTGAGCTTCAAACAAACCAGAATTATGTAGCAAAAAATGTTAAACCATTTTAAGTAAACCATTTCAATGATGTTGAAAAAGAAGACATTTCCCTCTCCTTTTTGTTTAACCAAACTAAACAAAATGGATGCAAAAAAAAAAGTTCTGGTTTTTTATCTATAA
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTCGATACTGCGCAGCCACGCGTTGCAAGAACCGGGGAGGCCAGGCGGCTGTAATCCAGCGCAAAGTGTCCTTTTACCCGTTTCCTTTGCATGACAGGGGAAGGCTTCAAGAATGGCTTCGAAATATGAAACAGTACAAATTGTATCCCACCAAGCATCAGGTCTTGTGCAGTGATCATTTTACTGCTGATTCCTTCAATATAAGATGGGGTATTCAGTATCTGAAACCTAACGCTATCCCTACTTTATTCTCTTTCACAGAAAAAATCCAGGATATAGCTGAGTTGGAACTTACCATAAAGGAAGGGACGCAAGATGGTGTGAAGGTTGATACAGACACTGTGCCATCACAGGATTTTTGTCCAAATGTAACAAACAATTTGAGTCATGGTTTTGATACAGATGAATATGTTGACCCTGATGACAAACAGGTTTATCTGAAGAATACAATCGATGGAATTACAGTTTCACAAAATAAGACAAAAGACTTGTATGTTCCAAATTCTGAATATGAAATCCAGCCCCATTTGATAACACCCTCTAAATTCCGTCAGACCTCTGTGGAAAATATGATTGTTAGCTCTGTAACTGACTTAAACAGCCAAAGTAATCAGGTGTACTTTGAGCTTCAAACAAACCAGAATTATGTAGCAAAAAATGTTAAACCATTTTAAGTAAACCATTTCAATGATGTTGAAAAAGAAGACATTTCCCTCTCCTTTTTGTTTAACCAAACTAAACAAAATGGATGCAAAAAAAAAAGTTCTGGTTTTTTATCTATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCGATACTGCGCAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838049
dbEST ID: 79655751
Trimmed Sequence: TACTATGACAATATCAACACTGCTCCCACAGTTTTCCAGAATCTTAAGTTTTTCATCAGATAGCAGATTTTCTTGCTTTAGTTTTGCAATGACTGACTCCAGTAATCGGAGACGGGACAGTGTTGCATTTTCTTGTGCTTCTAGGACTGCTATTTTTGACTGCAATTTTGCAATCTTTTGCCTGAGATAATGTCGGTCAGTAATTTGCCTGCAATATGAATGTTCAGATTCTAAGATTTCATTAGTGCTGTTTGCATCATTTTCAAAGCCAAGCTTTTCTGAACTGGTAAACTGAAGATTATCAGAAATGGCACTTCCATCTTGTCCACCTGGTACAATTATAGTAATAACAGAATCTTTCTCTGCATCCATCTGTTTAGTTTGCTTAACCAAACTGAGAGGAAATGTCTCTTTTTGCACATCACTGAAATGGTCTACTTGAAATGTGTCAACATTTTCTGCTACATAATTCTGGTCTGTTTGAAGCTCAGAGTACACCTGATTACTTTGGCTGTTTAAGTCAGCTACAGAGCTAACAATCATATTTTCCACAGAGGTCTGACGGATTTTAGAGGGTGTTATCAAATGGGGGCTGGAATTTCTAATTCAAAATTTTGGAAGAAAGAAATCTTTTTGTCTTTATTTTGTGAAAACTGGAGGTTCCAACCGAATGGAATCTTTCGTAAAAAAACCCAGTTTATTCCTTCAGGGGTCAAGAAGAGTGGGGGGGGTTATGAAAACCCAGAGAACCCCCAAAATGTTTGTGGTTG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACTATGACAATATCAACACTGCTCCCACAGTTTTCCAGAATCTTAAGTTTTTCATCAGATAGCAGATTTTCTTGCTTTAGTTTTGCAATGACTGACTCCAGTAATCGGAGACGGGACAGTGTTGCATTTTCTTGTGCTTCTAGGACTGCTATTTTTGACTGCAATTTTGCAATCTTTTGCCTGAGATAATGTCGGTCAGTAATTTGCCTGCAATATGAATGTTCAGATTCTAAGATTTCATTAGTGCTGTTTGCATCATTTTCAAAGCCAAGCTTTTCTGAACTGGTAAACTGAAGATTATCAGAAATGGCACTTCCATCTTGTCCACCTGGTACAATTATAGTAATAACAGAATCTTTCTCTGCATCCATCTGTTTAGTTTGCTTAACCAAACTGAGAGGAAATGTCTCTTTTTGCACATCACTGAAATGGTCTACTTGAAATGTGTCAACATTTTCTGCTACATAATTCTGGTCTGTTTGAAGCTCAGAGTACACCTGATTACTTTGGCTGTTTAAGTCAGCTACAGAGCTAACAATCATATTTTCCACAGAGGTCTGACGGATTTTAGAGGGTGTTATCAAATGGGGGCTGGAATTTCTAATTCAAAATTTTGGAAGAAAGAAATCTTTTTGTCTTTATTTTGTGAAAACTGGAGGTTCCAACCGAATGGAATCTTTCGTAAAAAAACCCAGTTTATTCCTTCAGGGGTCAAGAAGAGTGGGGGGGGTTATGAAAACCCAGAGAACCCCCAAAATGTTTGTGGTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACTATGACAATATCAACACTGCT