ORFeome > thbs1 ORF1 – XORFeome v1.0

thbs1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: thbs1
Gene ID: 865586
Gene Page ID: 486188
ORF Xenbase ID: 17300709

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054970
Original XGC clone length: 1491

Human orthology & disease relationships

NCBI Entrez ID: 7057
Ensembl gene IDs: ENSG00000137801
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 131300,132400,609192

Library Location

Plate ID: GDExl11003
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ839479
dbEST ID: 79657181
Trimmed Sequence: ATGGGGATGATGAAGGGAATTTTCCTACTGTTGATGTTGGCCATGCCTCAGACACATCAGGCAGCAGAATCTGGGAATGATGATAACAGTGTATTTGATCTGTTTGAGTTAACGGGATACAACCGCAAGGCTGGCTCTCGTAAGCCTGAAGGACTTCATTTAGTGAAGGGACCTGACCCTTCCAGCCCAGCTTATAGAATTGAAAATGCTGACTTGATCCCACCACTGCCAGAAGATAAATTTCAAGACTTGCTGGATGCAATACGTGCTGATAGAGGGTTCATCCTGTTGGCTACTCTGCGTCAAGCAAAGAAGAGTCGAGGGGCACTTATTTCTGTGGAGAGAAAAGATGGTGGTGGACACATCTTCAGTCTTATCTCCAATGGCCAGGCTGGAACCCTAGACTTAAGTTTAAGCGGAGAAAGGAAGCAGCAGGTGGTGTCTGTAGAAGATGCTGCTCTGGCTGATGGCAAGTGGAAGAACATCACTCTCTTTGTCCAAGAAGACCGCGCGCAACTCTATATAGGATGTGACAAGATGGAAAATGCTGAGCTAGATGTGCCAATACAAAAAATTTTCACTGAGAACCTGGCAAGCATTGCTCGTCTTCGAGTAGCAAAGGGAGGAGTAAAGGACAACTTTCAGGGAGTCCTTCAAAACGTGCGCTTTGTGTTTGGAACACATTAGAAGCTATTCTGAGAAACAAAGGCTGTCCCAGCATGACAAACTCAGTCATAACTTTGGACATGCAGTGAACGGCTCCAGCCCCACCATCCCAAACAATTTAGTTGGCCCACAAACAAAGAACCCGGCCTGCCTGGTGGGTGGCATTTCT
Full Trace Sequence: GGCCCCCTATAATGGATGTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGATGATGAAGGGAATTTTCCTACTGTTGATGTTGGCCATGCCTCAGACACATCAGGCAGCAGAATCTGGGAATGATGATAACAGTGTATTTGATCTGTTTGAGTTAACGGGATACAACCGCAAGGCTGGCTCTCGTAAGCCTGAAGGACTTCATTTAGTGAAGGGACCTGACCCTTCCAGCCCAGCTTATAGAATTGAAAATGCTGACTTGATCCCACCACTGCCAGAAGATAAATTTCAAGACTTGCTGGATGCAATACGTGCTGATAGAGGGTTCATCCTGTTGGCTACTCTGCGTCAAGCAAAGAAGAGTCGAGGGGCACTTATTTCTGTGGAGAGAAAAGATGGTGGTGGACACATCTTCAGTCTTATCTCCAATGGCCAGGCTGGAACCCTAGACTTAAGTTTAAGCGGAGAAAGGAAGCAGCAGGTGGTGTCTGTAGAAGATGCTGCTCTGGCTGATGGCAAGTGGAAGAACATCACTCTCTTTGTCCAAGAAGACCGCGCGCAACTCTATATAGGATGTGACAAGATGGAAAATGCTGAGCTAGATGTGCCAATACAAAAAATTTTCACTGAGAACCTGGCAAGCATTGCTCGTCTTCGAGTAGCAAAGGGAGGAGTAAAGGACAACTTTCAGGGAGTCCTTCAAAACGTGCGCTTTGTGTTTGGAACACATTAGAAGCTATTCTGAGAAACAAAGGCTGTCCCAGCATGACAAACTCAGTCATAACTTTGGACATGCAGTGAACGGCTCCAGCCCCACCATCCCAAACAATTTAGTTGGCCCACAAACAAAGAACCCGGCCTGCCTGGTGGGTGGCATTTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGATGATGAAGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839478
dbEST ID: 79657180
Trimmed Sequence: TCTCCGCCTCCAGTACCGCCTTGTCCCTTCTTGGCGTTCTTTCTCTTCACATGGCTTTCCGTTCAGCTGAGGAACAGGAGAGTTGCAAAGACGGATTCTGGTGATTTGACCACTTCCGCAGGTAACTGAACATGATGACCATGGTGACCAATGGCTCCAACCACCATCTTGCTTAAATCTCTTGTCACATTCCTGGATATGGCAAGACCGTGTCTGTACAGAGGAGCCTTCACAGGGGTTATTAAGGCTGTCGCAGGAACGTCCTCTCTGCTGGATGCCATGACCACAAGTCACAGAGCAAGGTGTCCAATCTGACCATGGAGACCAATCATCATCCGCTGAGTCACTTGGCCAACATCTAGGACAGCATTCTCCATCTGGAATGGTGGCATTGGTGCAGGGCATCAAAGGGCAAGATACTTTTCGGCATATAGTTGCTGAGTTCTGACATGTGCATTCAGTGCAGCTGTCAACGGTCCACTCATCTCTATTCTTATGCAAGACTCCATTGTGGAGACAAGCACCTGGCATCATTGTTATTCGCTTAGAAATAAGTTCATTTATCTCTGTCTCTTTGGTGACTTGGTCCTGGAGAGATTTTCCCAGAGTCTGTAAGCCTTTCATTTCTGCAAACAGTTCGGACAGTTAATTGCAGGAAATGCCAAACACAGCAAGCAAAATCCTTTGTTTTTGGGCCCAACTTAATTTCTTTCGAAATTGCTGGGGCCTTAAGACCGGTTCCGTGGCTTTTTTCCCAAAGTAAAAGGACAGGAAGTT
Full Trace Sequence: GAAAATGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTCCGCCTCCAGTACCGCCTTGTCCCTTCTTGGCGTTCTTTCTCTTCACATGGCTTTCCGTTCAGCTGAGGAACAGGAGAGTTGCAAAGACGGATTCTGGTGATTTGACCACTTCCGCAGGTAACTGAACATGATGACCATGGTGACCAATGGCTCCAACCACCATCTTGCTTAAATCTCTTGTCACATTCCTGGATATGGCAAGACCGTGTCTGTACAGAGGAGCCTTCACAGGGGTTATTAAGGCTGTCGCAGGAACGTCCTCTCTGCTGGATGCCATGACCACAAGTCACAGAGCAAGGTGTCCAATCTGACCATGGAGACCAATCATCATCCGCTGAGTCACTTGGCCAACATCTAGGACAGCATTCTCCATCTGGAATGGTGGCATTGGTGCAGGGCATCAAAGGGCAAGATACTTTTCGGCATATAGTTGCTGAGTTCTGACATGTGCATTCAGTGCAGCTGTCAACGGTCCACTCATCTCTATTCTTATGCAAGACTCCATTGTGGAGACAAGCACCTGGCATCATTGTTATTCGCTTAGAAATAAGTTCATTTATCTCTGTCTCTTTGGTGACTTGGTCCTGGAGAGATTTTCCCAGAGTCTGTAAGCCTTTCATTTCTGCAAACAGTTCGGACAGTTAATTGCAGGAAATGCCAAACACAGCAAGCAAAATCCTTTGTTTTTGGGCCCAACTTAATTTCTTTCGAAATTGCTGGGGCCTTAAGACCGGTTCCGTGGCTTTTTTCCCAAAGTAAAAGGACAGGAAGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTCCGCCTCCAGTACC