ORFeome > thbs3 ORF1 – XORFeome v1.0

thbs3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: thbs3
Gene ID: 5762006
Gene Page ID: 5761977
ORF Xenbase ID: 17300715

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC048222
Original XGC clone length: 2895

Human orthology & disease relationships

NCBI Entrez ID: 7059
Ensembl gene IDs: ENSG00000169231
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 131300,132400,609192

Library Location

Plate ID: GDExl11017
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ824330
dbEST ID: 79642032
Trimmed Sequence: ATGGGGAGACAGGACCCAACGAGGCGACATTTCCTACTGCTGCTACTGCTTCTTCTCTCCTGCTTCTTCTGCTGGGCACAGTCATCCAGGCAAGATGTGCACGTTATCGACCTCCTGACGGTCAGCGAGTCCCGGCACATGTCCGGTGTGGTGGAAAAGATTCGCTCTGAGCTGCTGGGTGTCAATGACCTCTACTTTCTCTCCACCTTCCGGCTGCCCCCCAAGGCAGGAGGGGTCCTGTTTGGTCTCTACTCTAAGAAGGATAACACCAAATGGCTGGAGGCCTCCATAGTGGGCAAGATCAACAAAGTGCTAGTGCGTTACATGAGGGAAGACTCCAAGCTCCATGCAGTCAGTTTACAGAATGCCAACCTGTCGGATGGAAACATGCACACTATGATTCTGCGTGTGAGCGGCTTCCGGGGGGACACACTCTCATTGGAACTGTATGTAGACTGCAAGCAGGTGGACACCAGCATGGGGCTTCCAGAAATGATGATCATTCCCCAGTTTGAGGTGGAGTCCGGGGATATCCGCTCTGGACACAAAGCCTACCTAAGGATGCAGGGATCTGTGGAGTCCATGAAACTGATCCTTGGTGGGTCCCTGGGTCGTGTGGGAGCACTAAGTGAGTGCCCTTTCCAAGAAGATGAGTCCATTCATAATACAGTCAACGGAGTGGTTAATTCTATCCTTGGTGAGCACACGAAAGCTTTGATCACTCAAATGACTCTCTTTCATAAAGTCTTAGCAGAGCTGAGAGAGGACATACGAAAACCAGGGTTAAAG
Full Trace Sequence: TATTGAATTTTATTTATGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAGACAGGACCCAACGAGGCGACATTTCCTACTGCTGCTACTGCTTCTTCTCTCCTGCTTCTTCTGCTGGGCACAGTCATCCAGGCAAGATGTGCACGTTATCGACCTCCTGACGGTCAGCGAGTCCCGGCACATGTCCGGTGTGGTGGAAAAGATTCGCTCTGAGCTGCTGGGTGTCAATGACCTCTACTTTCTCTCCACCTTCCGGCTGCCCCCCAAGGCAGGAGGGGTCCTGTTTGGTCTCTACTCTAAGAAGGATAACACCAAATGGCTGGAGGCCTCCATAGTGGGCAAGATCAACAAAGTGCTAGTGCGTTACATGAGGGAAGACTCCAAGCTCCATGCAGTCAGTTTACAGAATGCCAACCTGTCGGATGGAAACATGCACACTATGATTCTGCGTGTGAGCGGCTTCCGGGGGGACACACTCTCATTGGAACTGTATGTAGACTGCAAGCAGGTGGACACCAGCATGGGGCTTCCAGAAATGATGATCATTCCCCAGTTTGAGGTGGAGTCCGGGGATATCCGCTCTGGACACAAAGCCTACCTAAGGATGCAGGGATCTGTGGAGTCCATGAAACTGATCCTTGGTGGGTCCCTGGGTCGTGTGGGAGCACTAAGTGAGTGCCCTTTCCAAGAAGATGAGTCCATTCATAATACAGTCAACGGAGTGGTTAATTCTATCCTTGGTGAGCACACGAAAGCTTTGATCACTCAAATGACTCTCTTTCATAAAGTCTTAGCAGAGCTGAGAGAGGACATACGAAAACCAGGGTTAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAGACAGGACCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829689
dbEST ID: 79647391
Trimmed Sequence: ATTTTTCCCATCCAGTAGAAGTCGTCGGTATGGTTCAAAGTCTTCTGGAATTGTGTCATTACACCGGTACTGTAAATTGGACCAAATGATGTTTTCCTGGGAGAAGCAGAAGACCCCCAATCTTCCCCCTCTCATAGTTGTATCTATGATAACTCCAGAATCAGCCACCAGGTCAACTCCTTCATACAGCTTTACCCTGATGTAGCCCACTTGGGGTCTATGCATGAGCTGCCAGCGATAAGAAGTCTTGTCCTTCCAGCCAACGTTACGAGGGTCCTTCCATAGCAAACGAACCTGGTCTTGAGTGTGGCCGGTGTTCCATAGGGCATTGCGCAGCTGCTCGCCTGGGCCTGTTGTGGATTTCACAGCCTTCAGTTGTAGTCCAGGCTCTGCTACAGCTCGGAATGGGGTTGCCTGCCAGTAGGTCTGCTCTGTCTGTTTCCACATTACCACATAAAAGCTGGAGCTGTCCTGATAGCTGAAGATGAAGCCAGCATGGTCATCATCGGTCACAGTATTTACATGGAATGTCCCCTCAAAGTCCACCCCGTTGAAGGCCGTGTAACCAACTGCCAAGCCGGGGTCACTGTTCATCGTCTGAACAATCTCCATCCCCTGATTCAGCACAACCCAATTAGGGTCTATCTGAGCATCCCCCCTCGGGGTCTAAGAATACAGTCTGATAGGCTCTGAAAATCGGTGGAGAGTGACTTCCCGCACTTTCAGGAAAGAAAATCCAGGGGGGGTCGAATGAAGGATTTCATTTTATCAAAA
Full Trace Sequence: ACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTTTTCCCATCCAGTAGAAGTCGTCGGTATGGTTCAAAGTCTTCTGGAATTGTGTCATTACACCGGTACTGTAAATTGGACCAAATGATGTTTTCCTGGGAGAAGCAGAAGACCCCCAATCTTCCCCCTCTCATAGTTGTATCTATGATAACTCCAGAATCAGCCACCAGGTCAACTCCTTCATACAGCTTTACCCTGATGTAGCCCACTTGGGGTCTATGCATGAGCTGCCAGCGATAAGAAGTCTTGTCCTTCCAGCCAACGTTACGAGGGTCCTTCCATAGCAAACGAACCTGGTCTTGAGTGTGGCCGGTGTTCCATAGGGCATTGCGCAGCTGCTCGCCTGGGCCTGTTGTGGATTTCACAGCCTTCAGTTGTAGTCCAGGCTCTGCTACAGCTCGGAATGGGGTTGCCTGCCAGTAGGTCTGCTCTGTCTGTTTCCACATTACCACATAAAAGCTGGAGCTGTCCTGATAGCTGAAGATGAAGCCAGCATGGTCATCATCGGTCACAGTATTTACATGGAATGTCCCCTCAAAGTCCACCCCGTTGAAGGCCGTGTAACCAACTGCCAAGCCGGGGTCACTGTTCATCGTCTGAACAATCTCCATCCCCTGATTCAGCACAACCCAATTAGGGTCTATCTGAGCATCCCCCCTCGGGGTCTAAGAATACAGTCTGATAGGCTCTGAAAATCGGTGGAGAGTGACTTCCCGCACTTTCAGGAAAGAAAATCCAGGGGGGGTCGAATGAAGGATTTCATTTTATCAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTTTCCCATCCAGTAGAAGTC