ORFeome > thoc5 ORF1 – XORFeome v1.0

thoc5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: thoc5
Gene ID: 1015173
Gene Page ID: 1015167
ORF Xenbase ID: 17300745

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045075
Original XGC clone length: 2037

Human orthology & disease relationships

NCBI Entrez ID: 8563
Ensembl gene IDs: ENSG00000100296
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,125853

Library Location

Plate ID: GDExl11012
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ824026
dbEST ID: 79641728
Trimmed Sequence: ATGTCTTCAGATTCTTTAAAGAAAAGAAAACCCAAAGTGAATAGAAGTGAGGATGGAAAGAGGGGTCGCCACGATGAGCAGGAAGGCCGATATTACAGTGAAGAAGCTGAAGTAGATGTACGAGATTCAAGAGAAGACTATCAGCTGTACAAAGATACATGTGTTGCTTTGCAGAGATTGATGTCTGAAATTCAAGATTTAAAGAGCAAAGGAAGCAAAGACAGTGCTATGGAAATAGAAGAAAAGAAGATACAAAGTTGTGTGCACTTCATGACTCTGAAGAAACTCAATCGCTTGGCCAACATTCGACTTAAGAAAGCTCGAGACCAAACTCATGAGGCCAAGCAGAAGGTGGATGCATATAATTTGCAGCTGCAAAACTTGCTATATGAAGTCATGCATCTACAGAAAGAGATCACAAAATGTTTGGAGTTCAAATCAAAGCATGAAGAAATTGAGCTAGTTAGTGTGGAGGAATTTTACAGTGACGCACCTGCTGCCATAAGCAAGCCAGAAATTACTTCCACTGATCCCCACCAGCAAACCTTGTCCGTCAAATGGGGAGGCTTGGGAAAAAAAGAGAAAAGGGGCTTTGCAGAGAAGTACAAAGAGTGTCTGGCCAGCAAGGAGAAGATCCTGAAGGAGATTGAAATTAAGAAGGAATATCTTAACACTTTACAGCCACAACTTAACAGCATTATGCAGGCTTCACTGCCAGTTTCAGAATATTTATCCATGGCCTTTTGACTGCATGCATAAACCATAATGAGAACCGCGCGCCACCCTCCCCCCACCCTTTTGGTTGGGTGTTTT
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTCAGATTCTTTAAAGAAAAGAAAACCCAAAGTGAATAGAAGTGAGGATGGAAAGAGGGGTCGCCACGATGAGCAGGAAGGCCGATATTACAGTGAAGAAGCTGAAGTAGATGTACGAGATTCAAGAGAAGACTATCAGCTGTACAAAGATACATGTGTTGCTTTGCAGAGATTGATGTCTGAAATTCAAGATTTAAAGAGCAAAGGAAGCAAAGACAGTGCTATGGAAATAGAAGAAAAGAAGATACAAAGTTGTGTGCACTTCATGACTCTGAAGAAACTCAATCGCTTGGCCAACATTCGACTTAAGAAAGCTCGAGACCAAACTCATGAGGCCAAGCAGAAGGTGGATGCATATAATTTGCAGCTGCAAAACTTGCTATATGAAGTCATGCATCTACAGAAAGAGATCACAAAATGTTTGGAGTTCAAATCAAAGCATGAAGAAATTGAGCTAGTTAGTGTGGAGGAATTTTACAGTGACGCACCTGCTGCCATAAGCAAGCCAGAAATTACTTCCACTGATCCCCACCAGCAAACCTTGTCCGTCAAATGGGGAGGCTTGGGAAAAAAAGAGAAAAGGGGCTTTGCAGAGAAGTACAAAGAGTGTCTGGCCAGCAAGGAGAAGATCCTGAAGGAGATTGAAATTAAGAAGGAATATCTTAACACTTTACAGCCACAACTTAACAGCATTATGCAGGCTTCACTGCCAGTTTCAGAATATTTATCCATGGCCTTTTGACTGCATGCATAAACCATAATGAGAACCGCGCGCCACCCTCCCCCCACCCTTTTGGTTGGGTGTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTCAGATTCTTTAAAGAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829334
dbEST ID: 79647036
Trimmed Sequence: ACGGTGACTGAAAAATCCTTGAGGGTAATTATACTTGAATGGCTTAGTACGGCTCGGCCCCCTGAGGAGGCGCAGACAGATCTTTTCTGGAGGAAACTCGTGAGGTCCTTCCACGCTGTTGTCGTGGCGCTCAGTTTCTAGGTAGACATCTAACAGCATGCAGAGTCTCTGAATCTGGTTTGTCAGCAGCTGGAATCCTGGAGGAGGACCACACAGTTCCTTGTAGTAGACATTGACCTCACTCTCCATAACCCCAATATTGTCATCATTGCTGGATGAGCGTTCCCCTTTCCAGTTAAGGCAGAGGCTGAACACTGGAGGTACAGAGCTATAATCAGGGTTCAGAACCACTACTCCATTTAGTTTAGCTGTTCCACGCTCAATAAGCAGACAGAAATACTGGTCCGTTTCCTTTGCTAATCCACACTCTACAACATCCTTTGTATACGGCAGTGCTAGATAATCCTCATAGGCGATGACATTCCACTTTGTCAGTCTAGATATAACCTTGGCTGGGAAAAGAGATTGGCACTCCAAAGATACAGGTATACTACCATGTTCCAAGGAGGCAAACTGCCGGTGCAAAGATAATCGTGAAAGCAATCTGGTCTTCAGCAACTTAATAGTCTTCTCCATGGTAACTAGCACTGAAAAACCATTGTCTGCTACAAATTCAGGCCGGGGGTTGGGTCTGTTTGGAAAATGAAAATCCCTCCCCTTTGGTTTGGGGCCCCATACCTAAGGGGAAGTTCCCCAGTTTTTTTA
Full Trace Sequence: CTGACAGGAAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGGTGACTGAAAAATCCTTGAGGGTAATTATACTTGAATGGCTTAGTACGGCTCGGCCCCCTGAGGAGGCGCAGACAGATCTTTTCTGGAGGAAACTCGTGAGGTCCTTCCACGCTGTTGTCGTGGCGCTCAGTTTCTAGGTAGACATCTAACAGCATGCAGAGTCTCTGAATCTGGTTTGTCAGCAGCTGGAATCCTGGAGGAGGACCACACAGTTCCTTGTAGTAGACATTGACCTCACTCTCCATAACCCCAATATTGTCATCATTGCTGGATGAGCGTTCCCCTTTCCAGTTAAGGCAGAGGCTGAACACTGGAGGTACAGAGCTATAATCAGGGTTCAGAACCACTACTCCATTTAGTTTAGCTGTTCCACGCTCAATAAGCAGACAGAAATACTGGTCCGTTTCCTTTGCTAATCCACACTCTACAACATCCTTTGTATACGGCAGTGCTAGATAATCCTCATAGGCGATGACATTCCACTTTGTCAGTCTAGATATAACCTTGGCTGGGAAAAGAGATTGGCACTCCAAAGATACAGGTATACTACCATGTTCCAAGGAGGCAAACTGCCGGTGCAAAGATAATCGTGAAAGCAATCTGGTCTTCAGCAACTTAATAGTCTTCTCCATGGTAACTAGCACTGAAAAACCATTGTCTGCTACAAATTCAGGCCGGGGGTTGGGTCTGTTTGGAAAATGAAAATCCCTCCCCTTTGGTTTGGGGCCCCATACCTAAGGGGAAGTTCCCCAGTTTTTTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGGTGACTGAAAAATCCTTG