ORFeome > thoc7 ORF1 – XORFeome v1.0

thoc7 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: thoc7
Gene ID: 956295
Gene Page ID: 956289
ORF Xenbase ID: 17300763

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053810
Original XGC clone length: 606

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ839213
dbEST ID: 79656915
Trimmed Sequence: ATGGGAGCCGTCACCGACGATGAAGTTATCCGCAAAAGACTTTTGATTGATGGTGATGGTGCCGGAGATGACAGAAGAATTAACTTGTTGGTAAAGAGTTTTGTGAAATGGTGCAACTCCGGTTCCCAAGAGGAAGGATACAGCCAGTACCAGCGCATGCTGAGCAGCTTGTCTCAATGTGAATATTCCATGGGAAAAACGCTCCTAGTGCATGATATGAATCTGCGGGAAATGGAGAACTATGAAAAAATTTATGTTGATATAGAGAGTAGTATCGCTGCGGCACATGAGAAAATTGCAGAGTGCAAAAAACAGATCTTGCAAGCCAAGCGAATAAGGAAGAATCGCCAAGAATATGATGCATTAGCCAAAGTGATTGAGCAACATCCAGACAGGCACGAAACTCTAAAGCAGCTGGAAGCTTTAGATAAAGAGCTGAAACAGCTGTCGCACACTAAAGAAAATGCAGAAGACAAGCTGGAATTACGCAGGAAGCAGTTCCATGTTCTTCTCAGTACCATTCATGAGCTTCAACAGACTCTGGAAAATGATGACAAGCTTGCGGAAGAATCTCAGGAGTCACCGATGGAAACTCCAAATCCTTGGCAACTTTTTTTTTCAAAGGTGGGCTTTATAGAAAAGCATGGCTTAATAATTGGTGGCACGAAAAAGGTCACTATCATTCAAAAAAAAATCATTATTTGGCCATCCCCTCGAATCCCCCTTATGGTAGTTCCTATTAAAAAAAAAAAAAGAGAAAATTCAAAAAGGACCTCGGGGCCCCGGTGCCCAAAAATCGCCTAAGAGGG
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGCCGTCACCGACGATGAAGTTATCCGCAAAAGACTTTTGATTGATGGTGATGGTGCCGGAGATGACAGAAGAATTAACTTGTTGGTAAAGAGTTTTGTGAAATGGTGCAACTCCGGTTCCCAAGAGGAAGGATACAGCCAGTACCAGCGCATGCTGAGCAGCTTGTCTCAATGTGAATATTCCATGGGAAAAACGCTCCTAGTGCATGATATGAATCTGCGGGAAATGGAGAACTATGAAAAAATTTATGTTGATATAGAGAGTAGTATCGCTGCGGCACATGAGAAAATTGCAGAGTGCAAAAAACAGATCTTGCAAGCCAAGCGAATAAGGAAGAATCGCCAAGAATATGATGCATTAGCCAAAGTGATTGAGCAACATCCAGACAGGCACGAAACTCTAAAGCAGCTGGAAGCTTTAGATAAAGAGCTGAAACAGCTGTCGCACACTAAAGAAAATGCAGAAGACAAGCTGGAATTACGCAGGAAGCAGTTCCATGTTCTTCTCAGTACCATTCATGAGCTTCAACAGACTCTGGAAAATGATGACAAGCTTGCGGAAGAATCTCAGGAGTCACCGATGGAAACTCCAAATCCTTGGCAACTTTTTTTTTCAAAGGTGGGCTTTATAGAAAAGCATGGCTTAATAATTGGTGGCACGAAAAAGGTCACTATCATTCAAAAAAAAATCATTATTTGGCCATCCCCTCGAATCCCCCTTATGGTAGTTCCTATTAAAAAAAAAAAAAGAGAAAATTCAAAAAGGACCTCGGGGCCCCGGTGCCCAAAAATCGCCTAAGAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGCCGTCACCGA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGATTTTAATTTCCCTCCGGGGACCCCGGAAATCCTCCCCCAACCTGGCCACCATTTCCCAAAGCCGGTTGAACCCCAGGAAGGGAACTGAAAAAAACAGGAACCGGCTCCCGGCGAATTTCCGCCTGGCCTCCGGCATTTCCTTTATGGGGCAACACCGGTTCCACCCCTTTACCTAAGCCTCCCACCGGCTTTAAAGTTCCTGGCCGGCCGGAAGGTTGCCCAACCCCTTTGGCTAAGGCACCAAATCCTTGCCAATCCTCCCTAATCCCCTGGCCTTGCAAAACCGGTTTTTTCCACCCTCCAATTTTCCCAGGTCCCCCACCAATCCACCCCCCAATTTCACCTTAAATTTTTTCTAATTCCCCCTTTTCCCCCAAATCCAATCCAGCCCCTACAGCCTTTTTTCCATTGAAATATTCACATTAAAACAGCCTCTTCACCAGGCGCCTGTTCGGCCTGTGTCCTTCTTCTTGTAACCCGAATTTGCACCCTTTCAAAAAACTCCTATACAACAATTAATTCCTCCTGCCACCCCGCGCCCCCGCCCCTTCAATGCAAAGCCTTTTTGCGAATAGCGCCACAGCCGGGGACGCGCCCCAGGGGGCCTGGCGGTTTTGGTACAAAGGGGCGGTATAGAAGAACAATACCCCGCCGAGTGTTTTCTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAATTTTAGCCCCCCGGAGGGGGGCGCGGGCCACCCATTATAAACACCTCCGTGTAGGGGGGGGGCGGCCCCTGGGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGATTTTGAGTTTCCATCGGT