ORFeome > timm13 ORF1 – XORFeome v1.0

timm13 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: timm13
Gene ID: 6251644
Gene Page ID: 993978
ORF Xenbase ID: 17300829

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042226
Original XGC clone length: 291

Human orthology & disease relationships

NCBI Entrez ID: 26517
Ensembl gene IDs: ENSG00000099800
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 304700,311150

Library Location

Plate ID: GDExl11015
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ824246
dbEST ID: 79641948
Trimmed Sequence: ATGGACGGGTTTGGGTCTGACTTTTCCGTTGGGGGATCAAGCTCTGGGAAGGTTGATACCGGAGCAATAATGGAACAAGTTAAAGTGCAGATTGCAGTTGCTAACGCTCAGGAACTACTGCAGAGGATGACAGATAAATGTTTCCGAAAATGTATTGGAAAGCCAGGTGGATCTCTCGACAATTCTGAGCAGAAATGTGTTGCAATGTGCATGGACAGATATATGGATGCCTGGAACATAGTTTCTCGGGCATACAACTCAAGACTACAGCGAGAGCGTGCCAAGATGTT
Full Trace Sequence: CCATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACGGGTTTGGGTCTGACTTTTCCGTTGGGGGATCAAGCTCTGGGAAGGTTGATACCGGAGCAATAATGGAACAAGTTAAAGTGCAGATTGCAGTTGCTAACGCTCAGGAACTACTGCAGAGGATGACAGATAAATGTTTCCGAAAATGTATTGGAAAGCCAGGTGGATCTCTCGACAATTCTGAGCAGAAATGTGTTGCAATGTGCATGGACAGATATATGGATGCCTGGAACATAGTTTCTCGGGCATACAACTCAAGACTACAGCGAGAGCGTGCCAAGATGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTTAAAATGTTACATATCGACCTGCNGACTGGCTGTGTNTTTGGGAGCCTAGAATTTTTCTTCCCCTGACCGTCACGTTAATGGCGTTTTTGATGTCGTTTTCGCTGTGGCTGAGATCAACCTCTTCTTCCCCGATAACGGAAGACGGCACACTGGCCATATCGGTGGGCATCATGCGCCAGCTTTCATCCCCGATATGAACCACCAGGGTAAAATCAATGGGAGAATTAATTCGGAAGCCAGAGTGTATTGGGCAGGGGGGATCACCATTCGGTGGCCCGGGAGGGTGTCCAATATAATCATTCTGAAAACTTTCCCAAACAGAACGAAAAAACGGTTCTTTTCTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGGGTTTGGGTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829574
dbEST ID: 79647276
Trimmed Sequence: CATCTTGGCACGCTCTCGCTGTAGTCTTGAGTTGTATGCCCGAGAAACTATGTTCCAGGCATCCATATATCTGTCCATGCACATTGCAACACATTTCTGCTCAGAATTGTCGAGAGATCCACCTGGCTTTCCAATACATTTTCGGAAACATTTATCTGTCATCCTCTGCAGTAGTTCCTGAGCGTTAGCAACTGCAATCTGCACTTTAACTTGTTCCATTATTGCTCCGGTATCAACCTTCCCAGAGCTTGATCCCCCAACGGAAAAGTCAGACCCAAACCCGTCCATGG
Full Trace Sequence: GACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATCTTGGCACGCTCTCGCTGTAGTCTTGAGTTGTATGCCCGAGAAACTATGTTCCAGGCATCCATATATCTGTCCATGCACATTGCAACACATTTCTGCTCAGAATTGTCGAGAGATCCACCTGGCTTTCCAATACATTTTCGGAAACATTTATCTGTCATCCTCTGCAGTAGTTCCTGAGCGTTAGCAACTGCAATCTGCACTTTAACTTGTTCCATTATTGCTCCGGTATCAACCTTCCCAGAGCTTGATCCCCCAACGGAAAAGTCAGACCCAAACCCGTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACTGGAAATCGTTTTACAACTAAGTGGACTGGGACTTTTCCTGGCAGCTTCTGGCGCGAAAGCAATGTACTAATCAACTCCCCGTTTCATCTGTTTATGACGGCTCTATATAACGACCGTTAAACATAACTATGCACACGCTTCAGTCTGCCCTTAATTCAGCATGCTGCTCGTCAGGAGGAGGGCCCTTCCGTGAGTTTCGACTGGAAGTGAACGTACACTATGCTGCGCATATGGCAAGAGTGGCTCCCCATAGCGGCCTCATTATTGCCATGACCAAAACTAATTCGTTTTAAATCGCGTCCGGATAGGAAACCNCAACAAAACAATTTTCCGGGGAAAATTTAACACCCCAAATTTCATTGCGCAACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATCTTGGCACGCTCTCGCT