ORFeome > timm8b ORF1 – XORFeome v1.0

timm8b ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: timm8b
Gene ID: 6254561
Gene Page ID: 1010039
ORF Xenbase ID: 17300865

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078465
Original XGC clone length: 285

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ839734
dbEST ID: 79657436
Trimmed Sequence: ATGTCTGACTTTGATTCAAACCTGGATTTGGCGGGGACTGGAGCGAGTCCCGCGGAGGCTGCAGAACTGCAAAGGATGTTGGCGGTGGAACAGCAGAAAGCCCAGTTCACTGCACAGGTTCATAATTTTATGGATGTGTGCTGGGACAAATGCATTGACAGACCTGGAAACAAGCTGGATTCGCGGACTGAGAGCTGCTTGGTTAGCTGTGTAGACCGATTCATAGATACAACCTTGTCCATCACCAATCGGTTTGCTCAGATTGTACAGAAAGGAGCACATTT
Full Trace Sequence: GGTCTATAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGACTTTGATTCAAACCTGGATTTGGCGGGGACTGGAGCGAGTCCCGCGGAGGCTGCAGAACTGCAAAGGATGTTGGCGGTGGAACAGCAGAAAGCCCAGTTCACTGCACAGGTTCATAATTTTATGGATGTGTGCTGGGACAAATGCATTGACAGACCTGGAAACAAGCTGGATTCGCGGACTGAGAGCTGCTTGGTTAGCTGTGTAGACCGATTCATAGATACAACCTTGTCCATCACCAATCGGTTTGCTCAGATTGTACAGAAAGGAGCACATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCAAAGTCTGCCAAACACAAATGTTACAAAGGGTCCCCCATGCAGGGCCGGAAAAAAAAAAAAGAAAAAACGGAAAACCGGGGTTTCCGGTTAAACCTTCCGTGGAAAAAAAGAACGCCAAAAACCCCGAACACCCGGGGTGGCCGGGTTGACTTTGAAAGGGAGGAAAGGGGGGGCGCCCCCACGGCCCCAAAATAGCCCCACCCCCCGGGGGGGACCGCGGCGGAGGGGTTTTTTTGTGGTGTTTCCTCTCTTTTTTTTGGGTTTCCTAATCCCTCCGGGCCCCCAACACCCGGGGGGGGGGCACGGGGGGGCGGTGAGTGGGGTTTTTTTGTGAGGGTGGTTGTTGTTTCATTGGTGGTTTTTTTTTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGACTTTGATTCAAACCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839733
dbEST ID: 79657435
Trimmed Sequence: ATGTGCTCCTTTCTGTACAATCTGAGCAAACCGATTGGTGATGGACAAGGTTGTATCTATGAATCGGTCTACACAGCTAACCAAGCAGCTCTCAGTCCGCGAATCCAGCTTGTTTCCAGGTCTGTCAATGCATTTGTCCCAGCACACATCCATAAAATTATGAACCTGTGCAGTGAACTGGGCTTTCTGCTGTTCCACCGCCAACATCCTTTGCAGTTCTGCAGCCTCCGCGGGACTCGCTCCAGTCCCCGCCAAATCCAGGTTTGAATCAAAGTCAGACATGG
Full Trace Sequence: GGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGTGCTCCTTTCTGTACAATCTGAGCAAACCGATTGGTGATGGACAAGGTTGTATCTATGAATCGGTCTACACAGCTAACCAAGCAGCTCTCAGTCCGCGAATCCAGCTTGTTTCCAGGTCTGTCAATGCATTTGTCCCAGCACACATCCATAAAATTATGAACCTGTGCAGTGAACTGGGCTTTCTGCTGTTCCACCGCCAACATCCTTTGCAGTTCTGCAGCCTCCGCGGGACTCGCTCCAGTCCCCGCCAAATCCAGGTTTGAATCAAAGTCAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCGACCTTAATACTGGAAAAAATTTCACAACAAAGATGACATAAAAAGCTCGGAATAGACGGGACAGAAAAAAAAGAAGGCTCTCCCGTGAACACGGGGCTGCGCGGTAACCTTTTTTTGAAAATGAAAAAAACCAGGAAAACCAAGAAACAACGCGGGGGGTGTGTTGAATTTAGAAGGAAGGAGCGGGGAGGGCCCCCCCACGGGGCCAAAAAACATAACAAACCGGGGGGTGGGGGGGGGGGATGGGGGTTTTTTATGGTTTTTTGATATAATTTTTTTGTGGGAGAACAAACACGCGCGCCGGGCCACACCCCCAGGCGGGGTCTCGCTGCGGGGGGGGGTGTGTTTTAAATTTGNATGAGCANGCNNNGAAAAAGATGAAATNNNNGNAGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTGCTCCTTTCTGTACAATCT