ORFeome > timm8b ORF2 – XORFeome v1.0

timm8b ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: timm8b
Gene ID: 6256170
Gene Page ID: 1010039
ORF Xenbase ID: 17300871

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128951
Original XGC clone length: 285

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ838900
dbEST ID: 79656602
Trimmed Sequence: ATGTCTGACTTTGATTCAAACCTGGATTTGTCGGGGACCGGAGCGAATCCTGCCGAGGCTGCGGAACTGCAAAGGATGCTCGCGGTGGAACAGCAGAAAGCTCAGTTCACTGCCCAGGTTCACAATTTTATGGATGTCTGCTGGGACAAATGTGTGGACAGACCCGGAAACAAGCTGGATTCGCGGACTGAGAACTGTTTGGTTAGCTGTGTAGACCGGTTCATAGATACAACCTTGTCCGTCACCAATCGGTTCGCTCAGATTGTACAGAAGGGAGCACATTT
Full Trace Sequence: GGGCCCCTATAATAGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGACTTTGATTCAAACCTGGATTTGTCGGGGACCGGAGCGAATCCTGCCGAGGCTGCGGAACTGCAAAGGATGCTCGCGGTGGAACAGCAGAAAGCTCAGTTCACTGCCCAGGTTCACAATTTTATGGATGTCTGCTGGGACAAATGTGTGGACAGACCCGGAAACAAGCTGGATTCGCGGACTGAGAACTGTTTGGTTAGCTGTGTAGACCGGTTCATAGATACAACCTTGTCCGTCACCAATCGGTTCGCTCAGATTGTACAGAAGGGAGCACATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAGTACAAAAATAAAAAATATAACACATAGTTGCACTGACCGGCAAGAAAAAAAAGAAAAGACAAACCGATAACAGGGCTTTCGGTTGACCCGTTTTTGGAAAGAAAGGAAGCCAAACACCACGAAACCAAGGGGGTGGGGTTGAAAGTTGTATGCATGGAAGGGGGGGGGCCCCCAACGGCCCGAAACTTTACCAAGCCTTCGGGGTAAAGGGGGGGGGGGGGGGTTTTTGGGTTGGTGTCTCTTTTTTTTGGGGGGTATAAAAAACCCCCGGCACCCAACCCCCCGGGGGGGTACCCCGGGGGCGCGGTGTGTGGTTTTTTTTTTGGAAGATTATATTATAAAAACCAAATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGACTTTGATTCAAACCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838899
dbEST ID: 79656601
Trimmed Sequence: ATGTGCTCCCTTCTGTACAATCTGAGCGAACCGATTGGTGACGGACAAGGTTGTATCTATGAACCGGTCTACACAGCTAACCAAACAGTTCTCAGTCCGCGAATCCAGCTTGTTTCCGGGTCTGTCCACACATTTGTCCCAGCAGACATCCATAAAATTGTGAACCTGGGCAGTGAACTGAGCTTTCTGCTGTTCCACCGCGAGCATCCTTTGCAGTTCCGCAGCCTCGGCAGGATTCGCTCCGGTCCCCGACAAATCCAGGTTTGAATCAAAGTCAGACATGG
Full Trace Sequence: GGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTNACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAAATGTGCTCCCTTCTGTACAATCTGAGCGAACCGATTGGTGACGGACAAGGTTGTATCTATGAACCGGTCTACACAGCTAACCAAACAGTTCTCAGTCCGCGAATCCAGCTTGTTTCCGGGTCTGTCCACACATTTGTCCCAGCAGACATCCATAAAATTGTGAACCTGGGCAGTGAACTGAGCTTTCTGCTGTTCCACCGCGAGCATCCTTTGCAGTTCCGCAGCCTCGGCAGGATTCGCTCCGGTCCCCGACAAATCCAGGTTTGAATCAAAGTCAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAGAATCATTATTTGGGGCCCGACCTTAAGACTGGCCGTAAAAAAACAAAATCGAAACTGAGAGATAATTGGCACTTGGCCGGAAAAAAAAAAAAGAAAAGGAAAATCCAGCACACGGGGTTTCGTTGTTAGTGTGTTTTAGAAAAAAAAGCGCGCAGAAAAAAGGGAGCAGCGTTTGTTTTTTTTTTTTGTTTTGTAGGGGGCACACCGCCGCCCAGCCCCGAGAAAGACCCGCGGGAGAAGATGGTTTAGGGGGGGTGGGGGGGGGCGGTTGGCGTATGGGTATAATGTATATTTAGTTAAAGCTAGCCTCCCCCCGGCGGCCGGCGACCCGACCCCACAGCGGCAGCGGCCTCGGTGGAATGTGTGGTATGTGAAAGAGATAAGGATAAGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTGCTCCCTTCTGTACAATCT