ORFeome > timm9 ORF1 – XORFeome v1.0

timm9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: timm9
Gene ID: 983803
Gene Page ID: 983800
ORF Xenbase ID: 17300877

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097763
Original XGC clone length: 270

Human orthology & disease relationships

NCBI Entrez ID: 26520
Ensembl gene IDs: ENSG00000100575
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 304700,311150

Library Location

Plate ID: GDExl11089
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ838461
dbEST ID: 79656163
Trimmed Sequence: ATGGCGGCACAGATGTCCGAGTCTGATCAGATCAAACAGTTCAAAGAATTTCTTGGGACGTATAATAAACTGACCGAAAACTGTTTCCTGGATTGCGTGAAGGACTTCACAACAAGAGAAGTGAAGGCAGAAGAGATGACCTGCTCAGAACACTGCCTACAAAAGTATCTGAAAATGACCCAGAGGATATCAATGCGATTTCAGGAGTACCACATACAACAGAATGAAGCTTTAGCTGCTAAAGCCGGACTTCTTGGTCAGCCTAGATT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCACAGATGTCCGAGTCTGATCAGATCAAACAGTTCAAAGAATTTCTTGGGACGTATAATAAACTGACCGAAAACTGTTTCCTGGATTGCGTGAAGGACTTCACAACAAGAGAAGTGAAGGCAGAAGAGATGACCTGCTCAGAACACTGCCTACAAAAGTATCTGAAAATGACCCAGAGGATATCAATGCGATTTCAGGAGTACCACATACAACAGAATGAAGCTTTAGCTGCTAAAGCCGGACTTCTTGGTCAGCCTAGATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCAATGAAAAAAAAAATGATATATTAAACTGGCTCCTCGAGAACTGCCAAGACTGAAATGAAACGACATCGCTGCTACCCAAAGCCGGCGGGTGGCTCAACCCGTGGAAGGGGAGGAAAGCCCCACCCCCACGGAAATAAGCCCGGTGGGTCCGAATCGGATAAAGCTAAAAACGAGGCGCCAACCCCACTGGACCAAAACCCCTGTCCCAACCAAGGGGGGGTACGGGGCAAGTGGCGGTTTCGCGGGCTTGGCCAGACGGTTTTTATTAAGGCGGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCACAGATGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838460
dbEST ID: 79656162
Trimmed Sequence: TCTAGGCTGACCAAGAAGTCCGGCTTTAGCAGCTAAAGCTTCATTCTGTTGTATGTGGTACTCCTGAAATCGCATTGATATCCTCTGGGTCATTTTCAGATACTTTTGTAGGCAGTGTTCTGAGCAGGTCATCTCTTCTGCCTTCACTTCTCTTGTTGTGAAGTCCTTCACGCAATCCACGAAACATTTTTCGGTCAGTTTATTATACGTCCCAAGAAATTCTTTGAACTGTTTGATCTGATCAGACTCGGACATCTGTGCCGCCATGG
Full Trace Sequence: GCGGAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTNACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAATCTAGGCTGACCAAGAAGTCCGGCTTTAGCAGCTAAAGCTTCATTCTGTTGTATGTGGTACTCCTGAAATCGCATTGATATCCTCTGGGTCATTTTCAGATACTTTTGTAGGCAGTGTTCTGAGCAGGTCATCTCTTCTGCCTTCACTTCTCTTGTTGTGAAGTCCTTCACGCAATCCACGAAACATTTTTCGGTCAGTTTATTATACGTCCCAAGAAATTCTTTGAACTGTTTGATCTGATCAGACTCGGACATCTGTGCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTTCGGCCCGAGCTTGNAACATAGAAAACAAAAAAGATAGATTTACATGCCGACTCTGGAACTGCCAGGAAACAAATGAAACGACATGTCTGCTACGAAGGGTGGGGGGTGGGGCTATCTGGGGAACGGAAGGAAGCACGAAACGGTGGGAATAAACCCGGTGGGGTCGGAATCGGTAGTGGGAGATAGCGTAGGCGGGCACCCCACGGGCCAGGAACATGGCCGAACCCAGCGGGGGGGACGGGCGGGGTGGCCGGTTTCCTGGCTTTGGTATGGAGGGTTGTTTGGNGNGCGGNCAANTGGCGGCCGGGGCGGAAGAACAAGCGCCAGGAAACCCTGGGGGTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTAGGCTGACCAAGAAG