ORFeome > tinf2 ORF1 – XORFeome v1.0

tinf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tinf2
Gene ID: 6091858
Gene Page ID: 5731974
ORF Xenbase ID: 17300901

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126058
Original XGC clone length: 1095

Human orthology & disease relationships

NCBI Entrez ID: 26277
Ensembl gene IDs: ENSG00000092330
Directly associated (OMIM) disease MIM numbers: 268130,613990
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ837780
dbEST ID: 79655482
Trimmed Sequence: ATGGGAGTGCAGGGTGATCGGGAAGAAGGTTCAGCTGAATCAAGTGTGAATATGACACCAGACCTTCCTGCAGTGACCAGTGCTATTTGGCAGGTGATGCAGAGAAGAGAGACACAGCACTTTGGGAGAGTACTGGAGTTCTTGGAATTAGTCCATGCACAAGTGCCAGATCTGCTTTGTTACAGACACCATGCAAAACTTAGTGTAGGCCTAAGAGGAAAGATGGTGCTTGACATGGTTGAGAAAAGCTGCTCATTAATGTCAATTCTGACAGCGCTAAATCTCCATTTTCCCCCATCACTACCCGATGAGCCAAATACAGTGTTGCGGGACCACTCCAGACTCCAACGGTGCCATTCACATTTTCGCAAACTGGTTCTTCGATTGATACGGGATGATAAATTTCGTAGTAATTACATAGAGACAAAGCTACAAAGTGAATATGGGGAAACCTTCATGGCCAGTTTGGAGAAACTTCTGTGGGAATTTCTTTACCGGCTGCAGACTGTTTTAATTCACCAGCCTTTCGAGAGCCCAGAGGAAAGTCAACTTACACCGACACAGCTGCCTGGATCCCAGAAACAAGATATGTCAAAGAACTGCCTCTTTCCATTGGATGACCATACTTTCACCAGCTGCTCTCTTTTGCAGAATGATCCACATCTAAATTTTTTCAAACCCTCCGGCTACCCTTTACCACTGGAAAACCTGAAAAATGAAGAAAAAACCAGAATAACCAAGTTCTTTGCACTTGGGG
Full Trace Sequence: CGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGTGCAGGGTGATCGGGAAGAAGGTTCAGCTGAATCAAGTGTGAATATGACACCAGACCTTCCTGCAGTGACCAGTGCTATTTGGCAGGTGATGCAGAGAAGAGAGACACAGCACTTTGGGAGAGTACTGGAGTTCTTGGAATTAGTCCATGCACAAGTGCCAGATCTGCTTTGTTACAGACACCATGCAAAACTTAGTGTAGGCCTAAGAGGAAAGATGGTGCTTGACATGGTTGAGAAAAGCTGCTCATTAATGTCAATTCTGACAGCGCTAAATCTCCATTTTCCCCCATCACTACCCGATGAGCCAAATACAGTGTTGCGGGACCACTCCAGACTCCAACGGTGCCATTCACATTTTCGCAAACTGGTTCTTCGATTGATACGGGATGATAAATTTCGTAGTAATTACATAGAGACAAAGCTACAAAGTGAATATGGGGAAACCTTCATGGCCAGTTTGGAGAAACTTCTGTGGGAATTTCTTTACCGGCTGCAGACTGTTTTAATTCACCAGCCTTTCGAGAGCCCAGAGGAAAGTCAACTTACACCGACACAGCTGCCTGGATCCCAGAAACAAGATATGTCAAAGAACTGCCTCTTTCCATTGGATGACCATACTTTCACCAGCTGCTCTCTTTTGCAGAATGATCCACATCTAAATTTTTTCAAACCCTCCGGCTACCCTTTACCACTGGAAAACCTGAAAAATGAAGAAAAAACCAGAATAACCAAGTTCTTTGCACTTGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGTGCAGGGTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837779
dbEST ID: 79655481
Trimmed Sequence: TGATTTTTTTCCCAACAATGTTTCCATCTCCTGAGACTGAAAAGGATTTGGAGGAGAAAGGTTTCCATAACTATCTACCTCCAAAGTGCAATCCAGTCCAAAAATATCAAAAACAGATGTCTTACAACGTGGTCTCTTTAGACTGGCCATCGATATGGTTCCAGCGTCATGATGCCCAACATCAGTGACAAGGTTGCCATTATGTAAAGCTTCATTTCCAGAAGACTCAGAATCAGCAATATGTGGCATGGAGGCCTTGGAATCCATCAAGGTTTGTTTTGGCTGAGTAGAATTTTGTTCAGTCTCACATTGCAGTGGAAAAAGATCTTGTTCCTCTTCATCACCCACAGTGCAAGACTTGTTCATATGGTTTTTCCTCATTTTCAGTTCTTCCGTAGTAAACGTAGCAGGAGGCTTTGAAAAATTTAGATGTGGATCATTCTGCAGAAGAGAGCAGCTGGGTGAAGTATGGTCATCCACTGGAAAGAGGCAGTTCTTTGACATATCTTGTTTCTGGGATCCAAGCAGCTGTGTCGGTGTAAGTTGACTTTCCTCTGGGCTCTCGAAAGGCGGGGGAATTAAAACAGTCTGCAGCGCGTAAAGAATTAACACAAAAATTTCTCCAAACTGGCGATGAGGGTTGCCCCCATTCACATTGTAACTTTGTGTCTGGGTAATTACTAAAAAATATATCATCCCGGGGCGATGAAAAAAAAGTATTCTAAAATTAAATGGGACCGGGGGGAGTCGGGGGGGGGCCCCGCACGCATGAATTTTGCTCTTGCGAAGTGGGGGGGGGAGAGGGGAAAAAGAAAAATTGCAGAAAAAAAAGAAAAAAAAAACTTGTGCCGGCGGGCTCCGGCAGGGCGGGGCAGGTCTAGGCGAAGGGAGGAGGTGGGGGGGGGGGGGGGGAGGGGGGGGGAGGGGGAGAAATGATGACCGGGACTAATTTGCAACAAGGAAGGGGGAGACGGGGGGGGGGGGGAAGGTGGGGGTATGGGGGTGCGGGGCGCCGGGCGCGGACCCGGGAAAGGGGGGGGGAAAGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTACGGTAGGGTGAGGAGAGAAGCGGCGCGGGGGAGCAACAACGCGGCCGCGGGGGGGGGGCGGGGCGAGGGGGG
Full Trace Sequence: GGGCGTGAAACAGCCATTGAACANTGTAAAACGAACCACTATACGGGGAAACCAGCCTGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGATTTTTTTCCCAACAATGTTTCCATCTCCTGAGACTGAAAAGGATTTGGAGGAGAAAGGTTTCCATAACTATCTACCTCCAAAGTGCAATCCAGTCCAAAAATATCAAAAACAGATGTCTTACAACGTGGTCTCTTTAGACTGGCCATCGATATGGTTCCAGCGTCATGATGCCCAACATCAGTGACAAGGTTGCCATTATGTAAAGCTTCATTTCCAGAAGACTCAGAATCAGCAATATGTGGCATGGAGGCCTTGGAATCCATCAAGGTTTGTTTTGGCTGAGTAGAATTTTGTTCAGTCTCACATTGCAGTGGAAAAAGATCTTGTTCCTCTTCATCACCCACAGTGCAAGACTTGTTCATATGGTTTTTCCTCATTTTCAGTTCTTCCGTAGTAAACGTAGCAGGAGGCTTTGAAAAATTTAGATGTGGATCATTCTGCAGAAGAGAGCAGCTGGGTGAAGTATGGTCATCCACTGGAAAGAGGCAGTTCTTTGACATATCTTGTTTCTGGGATCCAAGCAGCTGTGTCGGTGTAAGTTGACTTTCCTCTGGGCTCTCGAAAGGCGGGGGAATTAAAACAGTCTGCAGCGCGTAAAGAATTAACACAAAAATTTCTCCAAACTGGCGATGAGGGTTGCCCCCATTCACATTGTAACTTTGTGTCTGGGTAATTACTAAAAAATATATCATCCCGGGGCGATGAAAAAAAAGTATTCTAAAATTAAATGGGACCGGGGGGAGTCGGGGGGGGGCCCCGCACGCATGAATTTTGCTCTTGCGAAGTGGGGGGGGGAGAGGGGAAAAAGAAAAATTGCAGAAAAAAAAGAAAAAAAAAACTTGTGCCGGCGGGCTCCGGCAGGGCGGGGCAGGTCTAGGCGAAGGGAGGAGGTGGGGGGGGGGGGGGGGAGGGGGGGGGAGGGGGAGAAATGATGACCGGGACTAATTTGCAACAAGGAAGGGGGAGACGGGGGGGGGGGGGAAGGTGGGGGTATGGGGGTGCGGGGCGCCGGGCGCGGACCCGGGAAAGGGGGGGGGAAAGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTACGGTAGGGTGAGGAGAGAAGCGGCGCGGGGGAGCAACAACGCGGCCGCGGGGGGGGGGCGGGGCGAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGATTTTTTTCCCAACAATGTTT