ORFeome > tjp2 ORF1 – XORFeome v1.0

tjp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tjp2
Gene ID: 6252798
Gene Page ID: 480466
ORF Xenbase ID: 17300925

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123164
Original XGC clone length: 1293

Human orthology & disease relationships

NCBI Entrez ID: 9414
Ensembl gene IDs: ENSG00000119139
Directly associated (OMIM) disease MIM numbers: 607748,615878
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,125800,146800,161800,164200,182290,186100,194050,266140,301000,304400,313900,600652,603278,603622,605249,607748,607841,608751

Library Location

Plate ID: GDExl11088
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ838161
dbEST ID: 79655863
Trimmed Sequence: ATGGCTGTCAGATCTCAGTACCAGCAGGGGTATGGACTGGAAGATGTGGTGTGGGAACAGTATACTGTCACATTGCAAAAGGATCCCAGAAAAGGATTTGGCATTGCCGTTTCTGGAGGAAGAGACAATCCACACTTCCAAAATGGTGAAAACTCCATTGTGATCTCAGACGTACTTATAGGTGGGCCTGCAGAGGGTCGACTTCTTGAGAATGACAGGGTTATAATGGTTAATGGAACCCTTCTTGAGAATGTGCCACATTCGTTTGCTGTTCAGCAGCTGAGAAAATGCGGGAAAACAGCAGTTCTGGTAGTGAAAAGACCAAGGAAGGTACAGTTGGGTCCTTCAAGCAAATCATATCCTGCCTCATATGTAATGGATGACTATTCTGAATATGAAAGCACAACTGCCTATAGTGCATATAGTGACAGGAGTGGATATGGGGGTTCCCACAGCCGTGATCCAATCCCACACATAAACATTCGAATGGACCAAGATAAAGATCAATATCATGAACATCAACAGGGTGGTTATGGCAACCGCGCCAGAGGTGGTGACGCGCAACTTAATATTTAATGTGGGAGGAGGGAAAAACGCAGGGCACGTAGGGGGGGGGGGGCGGAATGGGGGCGGAGCACCTTAACGAGGGCAGGAGACAAAAACCACTCT
Full Trace Sequence: GAGGCCTCGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGTCAGATCTCAGTACCAGCAGGGGTATGGACTGGAAGATGTGGTGTGGGAACAGTATACTGTCACATTGCAAAAGGATCCCAGAAAAGGATTTGGCATTGCCGTTTCTGGAGGAAGAGACAATCCACACTTCCAAAATGGTGAAAACTCCATTGTGATCTCAGACGTACTTATAGGTGGGCCTGCAGAGGGTCGACTTCTTGAGAATGACAGGGTTATAATGGTTAATGGAACCCTTCTTGAGAATGTGCCACATTCGTTTGCTGTTCAGCAGCTGAGAAAATGCGGGAAAACAGCAGTTCTGGTAGTGAAAAGACCAAGGAAGGTACAGTTGGGTCCTTCAAGCAAATCATATCCTGCCTCATATGTAATGGATGACTATTCTGAATATGAAAGCACAACTGCCTATAGTGCATATAGTGACAGGAGTGGATATGGGGGTTCCCACAGCCGTGATCCAATCCCACACATAAACATTCGAATGGACCAAGATAAAGATCAATATCATGAACATCAACAGGGTGGTTATGGCAACCGCGCCAGAGGTGGTGACGCGCAACTTAATATTTAATGTGGGAGGAGGGAAAAACGCAGGGCACGTAGGGGGGGGGGGGCGGAATGGGGGCGGAGCACCTTAACGAGGGCAGGAGACAAAAACCACTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGTCAGATCTCAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838160
dbEST ID: 79655862
Trimmed Sequence: TGGCTCCTTAGACCTTGGATTCCTCCTCTTGTGTGAATGATCCTCTTCCATTTCCGAATCACTGTCTTCCACATAAGGCAGATTAATCAGTGTCTGTTTTTTGTCTCTAAGAACCACAAGCTGAAGCTTCCCTCGAGATTTCTCTATTAAAGCCTGGGCATCCAGTAAAGACATGTTCTCAGTCAGAGTACCGTTAATCTTGAGTATGATATCTCCTTCATGCAAATTCCCATCTTTTCCTGCCAAACCAGTGCCTGTCAACCCCTTGATGTAGATCTGGCTGCCAAGGCGAAGGCCATATTCTTCATTTTTCTTGTTCTTTGTCAGAAGAACACTCTTGGTTTTGTCTGAACCTTTATTTGGTTGAGGTGATGGGCTACGAGACTGTAGCCTATCTCGACTACGGCTTTTCTGAATTTCCTTTTCCTAGGTTCTCCTTTCTGTATCTCTCTCCTGAACTGTAATCTCCACCCTCTGTCATAACTCTCATCCCCAATCTTATATGGCGTCCCGGAACAAAT
Full Trace Sequence: GCAGGATAGAGTACGACTCCTTGGGGGTGAGGACGCTATGACATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGCTCCTTAGACCTTGGATTCCTCCTCTTGTGTGAATGATCCTCTTCCATTTCCGAATCACTGTCTTCCACATAAGGCAGATTAATCAGTGTCTGTTTTTTGTCTCTAAGAACCACAAGCTGAAGCTTCCCTCGAGATTTCTCTATTAAAGCCTGGGCATCCAGTAAAGACATGTTCTCAGTCAGAGTACCGTTAATCTTGAGTATGATATCTCCTTCATGCAAATTCCCATCTTTTCCTGCCAAACCAGTGCCTGTCAACCCCTTGATGTAGATCTGGCTGCCAAGGCGAAGGCCATATTCTTCATTTTTCTTGTTCTTTGTCAGAAGAACACTCTTGGTTTTGTCTGAACCTTTATTTGGTTGAGGTGATGGGCTACGAGACTGTAGCCTATCTCGACTACGGCTTTTCTGAATTTCCTTTTCCTAGGTTCTCCTTTCTGTATCTCTCTCCTGAACTGTAATCTCCACCCTCTGTCATAACTCTCATCCCCAATCTTATATGGCGTCCCGGAACAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGCTCCTTAGACCTTGGATT