ORFeome > tm4sf1 ORF1 – XORFeome v1.0

tm4sf1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tm4sf1
Gene ID: 853120
Gene Page ID: 853116
ORF Xenbase ID: 17300973

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078602
Original XGC clone length: 612

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ839840
dbEST ID: 79657542
Trimmed Sequence: ATGTGCTACGGCAGGTGTGCAAGATGTATTGGCTACTTTCTTCTCGTTCTGGCACTATTCTGCATTGTGGCAAACATTTTACTTTATTTTCCCAATGGAGAGACCCAGTATGCATCACAGAACCACTTGAGTAGATTCGTATGGTTCTTCCAAGGCATTGGTGGTGCAGGGTTACTGATGCTGCTCCCAGCAGGAGTATTCATTGGGCTGGAACATGAAGATTGTTGTGGCTGCTGCGGCCATGAGAAATGTGGGAAAAGCTGTGCAATGCTGTCATCTATTTTGGCTGCATTAATTGGAGTTGCTGGAGCTGGATACTGTGTTGTTATTTCTGCATTGGGCTTAGTTGAGGGGCCACTGTGTTTAAACAGCGGAGAGTGGTCTTATGCATTCAGTGGCACTAATGGACAATATCTGACAAATCATCAATCCTGGTCCACATGTAGCGAACCAAAGAATGTTGTTGTGTGGAATGTTACTTTGTTTTCCATACTTCTGGGTCTGTCTGGAATCCAGGTCATCCTGTGCCTAATTCAAATCATTAATGGTTTAATTGGTGGGATATGGTGGTGTGTGGTGCTGCCAACAAAACTCACAAATCCTACATTTTACTTACTGGGTTTCTTGTACAAATTTATGCATTATAATAAAACATTTGTTTAAGATTTTGTTTGCACCCAAAAGGGTTCCCAATTAATTTCAAAATATATTCATTATTTTGTAACCCACCCCCNTTAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAACAAACAAAAATACACAAGAACCCCCCCAAGCGAAAAAAAGGC
Full Trace Sequence: GCTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGCTACGGCAGGTGTGCAAGATGTATTGGCTACTTTCTTCTCGTTCTGGCACTATTCTGCATTGTGGCAAACATTTTACTTTATTTTCCCAATGGAGAGACCCAGTATGCATCACAGAACCACTTGAGTAGATTCGTATGGTTCTTCCAAGGCATTGGTGGTGCAGGGTTACTGATGCTGCTCCCAGCAGGAGTATTCATTGGGCTGGAACATGAAGATTGTTGTGGCTGCTGCGGCCATGAGAAATGTGGGAAAAGCTGTGCAATGCTGTCATCTATTTTGGCTGCATTAATTGGAGTTGCTGGAGCTGGATACTGTGTTGTTATTTCTGCATTGGGCTTAGTTGAGGGGCCACTGTGTTTAAACAGCGGAGAGTGGTCTTATGCATTCAGTGGCACTAATGGACAATATCTGACAAATCATCAATCCTGGTCCACATGTAGCGAACCAAAGAATGTTGTTGTGTGGAATGTTACTTTGTTTTCCATACTTCTGGGTCTGTCTGGAATCCAGGTCATCCTGTGCCTAATTCAAATCATTAATGGTTTAATTGGTGGGATATGGTGGTGTGTGGTGCTGCCAACAAAACTCACAAATCCTACATTTTACTTACTGGGTTTCTTGTACAAATTTATGCATTATAATAAAACATTTGTTTAAGATTTTGTTTGCACCCAAAAGGGTTCCCAATTAATTTCAAAATATATTCATTATTTTGTAACCCACCCCCNTTAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAACAAACAAAAATACACAAGAACCCCCCCAAGCGAAAAAAAGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCTACGGCAGGTGTGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839839
dbEST ID: 79657541
Trimmed Sequence: GCAAACGTAGGACTGTGATGTATCTTGGCAGCACCACACACCACATATCCCACCAATTAAACCATTAATGATCTGAATTAGGCACAGGATGACCTGGATTCCAGACAGACCCAGAAGTATGGAAAACAAAGTAACATTCCACACAACAACATTCTTTGGTTCGCTACATGTGGACCAGGATTGATGATTTGTCAGATATTGTCCATTAGTGCCACTGAATGCATAAGACCACTCTCCGCTGTTTAAACACAGTGGCCCCTCAACTAAGCCCAATGCAGAAATAACAACACAGTATCCAGCTCCAGCAACTCCNATTAATGCAGCCAAAATAGATGACAGCATTGCACAGCTTTTCCCACATTTCTCATGGCCGCAGCAGCCACAACAATCTTCATGTTCCAGCCCAATGAATACTCCTGCTGGGAGCAGCATCAGTAACCCTGCACCACCAATGCCTTGGAAGAACCATACGAATCTACTCAAGTGGTTCTGTGATGCATACTGGGTCTCTCCATTGGGAAAATAAAGTAAAATGTTTGCCACAATGCACAATAGTGCCAGAACGAGAAGAAAGTAGCCAATACATCTTGCACACCTGCCGTAGCACATGG
Full Trace Sequence: GGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAAACGTAGGACTGTGATGTATCTTGGCAGCACCACACACCACATATCCCACCAATTAAACCATTAATGATCTGAATTAGGCACAGGATGACCTGGATTCCAGACAGACCCAGAAGTATGGAAAACAAAGTAACATTCCACACAACAACATTCTTTGGTTCGCTACATGTGGACCAGGATTGATGATTTGTCAGATATTGTCCATTAGTGCCACTGAATGCATAAGACCACTCTCCGCTGTTTAAACACAGTGGCCCCTCAACTAAGCCCAATGCAGAAATAACAACACAGTATCCAGCTCCAGCAACTCCNATTAATGCAGCCAAAATAGATGACAGCATTGCACAGCTTTTCCCACATTTCTCATGGCCGCAGCAGCCACAACAATCTTCATGTTCCAGCCCAATGAATACTCCTGCTGGGAGCAGCATCAGTAACCCTGCACCACCAATGCCTTGGAAGAACCATACGAATCTACTCAAGTGGTTCTGTGATGCATACTGGGTCTCTCCATTGGGAAAATAAAGTAAAATGTTTGCCACAATGCACAATAGTGCCAGAACGAGAAGAAAGTAGCCAATACATCTTGCACACCTGCCGTAGCACATGGTGGCAACTTTTTTGTACAAAGTTGGCATTATTAAAAAAGCATTGCTCATCAATTTTGTTGCAACCAAACAGGTCACTAATCATTCAAAATAAAAATCATTTATTTGGAAACAAAAAAACATAAAACCTGGCCATTCTTTATGCCAGGCTCCCCTCGTGGGACGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAAACGTAGGACTGTGA