ORFeome > tm4sf4 ORF1 – XORFeome v1.0

tm4sf4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tm4sf4
Gene ID: 6254228
Gene Page ID: 973567
ORF Xenbase ID: 17300985

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054239
Original XGC clone length: 594

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ839546
dbEST ID: 79657248
Trimmed Sequence: ATGTGTTCCGGTGGTTGCGCAAAGTGCTTGGGCATTACCCTTATACCACTAGCCATTCTGTGTATATTGGCTAATATATTATTATTTTTCCCTGGAGGAACCATTGCTGATAAAAATGACCATATCTCGGATGAAGTTTGGTACTTTGGAGGAATAGTGGGCTCCGGAGTTCTGATGATTTTTCCAGCATTGGTGTTTCTGGGTCTAAAGAACAATGACTGCTGTGGGTGTTGTGGCAACGAGAGCTGTGGCAAAAGATTTGCTATGTTCACCTCTATCATATTTGCTGCTATTGGCTTTGTTGGAGCGGGCTACTGCTTTATTGTGTCAGCAGTTGCCATTGATAAAGGACCAAAATGTGATTTTGGAAATGGAAATTATACTTATGCCTCCCAGGAAACAGAGCTCTCTTGGAAAGATTGTGTAGAACCTCCTAACATTGGTGAGTGGAATTTGACCCTCTTCTGCTTGCTCCTATTGATGAGTGGTGTTCAAGCCGTACTCTGCGCCATTCAAGCGATCAACGGACTCATAGGGACAATCTGCGGGGACTGCAAATGTTGTGGATGTTGTGGGGGTGACGGTCCCGTTTT
Full Trace Sequence: TCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTTCCGGTGGTTGCGCAAAGTGCTTGGGCATTACCCTTATACCACTAGCCATTCTGTGTATATTGGCTAATATATTATTATTTTTCCCTGGAGGAACCATTGCTGATAAAAATGACCATATCTCGGATGAAGTTTGGTACTTTGGAGGAATAGTGGGCTCCGGAGTTCTGATGATTTTTCCAGCATTGGTGTTTCTGGGTCTAAAGAACAATGACTGCTGTGGGTGTTGTGGCAACGAGAGCTGTGGCAAAAGATTTGCTATGTTCACCTCTATCATATTTGCTGCTATTGGCTTTGTTGGAGCGGGCTACTGCTTTATTGTGTCAGCAGTTGCCATTGATAAAGGACCAAAATGTGATTTTGGAAATGGAAATTATACTTATGCCTCCCAGGAAACAGAGCTCTCTTGGAAAGATTGTGTAGAACCTCCTAACATTGGTGAGTGGAATTTGACCCTCTTCTGCTTGCTCCTATTGATGAGTGGTGTTCAAGCCGTACTCTGCGCCATTCAAGCGATCAACGGACTCATAGGGACAATCTGCGGGGACTGCAAATGTTGTGGATGTTGTGGGGGTGACGGTCCCGTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAACATTGCCTAATATTTTGGTGCAACTAATGGGTCACTATCATTCCAAATAAAATCATTATTTTTCCACCCGGTCTTAATATAGACAAAATTATAACAAAAAAAAAAAGAAAAAAAAAAAAATACTCGGGCCACCCTTTGGCCCAAAGTCTCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTTCCGGTGGTTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839545
dbEST ID: 79657247
Trimmed Sequence: AACGGGACCGTCACCCCCACAACATCCACAACATTTGCAGTCCCCGCAGATTGTCCCTATGAGTCCGTTGATCGCTTGAATGGCGCAGAGTACGGCTTGAACACCACTCATCAATAGGAGCAAGCAGAAGAGGGTCAAATTCCACTCACCAATGTTAGGAGGTTCTACACAATCTTTCCAAGAGAGCTCTGTTTCCTGGGAGGCATAAGTATAATTTCCATTTCCAAAATCACATTTTGGTCCTTTATCAATGGCAACTGCTGACACAATAAAGCAGTAGCCCGCTCCAACAAAGCCAATAGCAGCAAATATGATAGAGGTGAACATAGCAAATCTTTTGCCACAGCTCTCGTTGCCACAACACCCACAGCAGTCATTGTTCTTTAGACCCAGAAACACCAATGCTGGAAAAATCATCAGAACTCCGGAGCCCACTATTCCTCCAAAGTACCAAACTTCATCCGAGATATGGTCATTTTTATCAGCAATGGTTCCTCCAGGGAAAAATAATAATATATTAGCCAATATACACAGAATGGCTAGCGGTATAATGGTAATGCCCAAGCACTTTGCGCAACCACTCGAAAACATGGTGGCCAATTTTTTGTACCAAGTTGGCATTATTAAAAACCATTCCTCACCATTTTATGCAACCAAAAAGTTACTATCAACTCCAAGAAAAAATCATTAAATAAAAAAAACAACAAAAAGAACGGGCCCGTCGGTTTCAAAACCCTCCTGTAAAAGGAGGAAAA
Full Trace Sequence: GGGAAACAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACGGGACCGTCACCCCCACAACATCCACAACATTTGCAGTCCCCGCAGATTGTCCCTATGAGTCCGTTGATCGCTTGAATGGCGCAGAGTACGGCTTGAACACCACTCATCAATAGGAGCAAGCAGAAGAGGGTCAAATTCCACTCACCAATGTTAGGAGGTTCTACACAATCTTTCCAAGAGAGCTCTGTTTCCTGGGAGGCATAAGTATAATTTCCATTTCCAAAATCACATTTTGGTCCTTTATCAATGGCAACTGCTGACACAATAAAGCAGTAGCCCGCTCCAACAAAGCCAATAGCAGCAAATATGATAGAGGTGAACATAGCAAATCTTTTGCCACAGCTCTCGTTGCCACAACACCCACAGCAGTCATTGTTCTTTAGACCCAGAAACACCAATGCTGGAAAAATCATCAGAACTCCGGAGCCCACTATTCCTCCAAAGTACCAAACTTCATCCGAGATATGGTCATTTTTATCAGCAATGGTTCCTCCAGGGAAAAATAATAATATATTAGCCAATATACACAGAATGGCTAGCGGTATAATGGTAATGCCCAAGCACTTTGCGCAACCACTCGAAAACATGGTGGCCAATTTTTTGTACCAAGTTGGCATTATTAAAAACCATTCCTCACCATTTTATGCAACCAAAAAGTTACTATCAACTCCAAGAAAAAATCATTAAATAAAAAAAACAACAAAAAGAACGGGCCCGTCGGTTTCAAAACCCTCCTGTAAAAGGAGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACGGGACCGTCACCCCCA