ORFeome > tm9sf4 ORF1 – XORFeome v1.0

tm9sf4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tm9sf4
Gene ID: 993569
Gene Page ID: 993564
ORF Xenbase ID: 17301015

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124851
Original XGC clone length: 1929

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ838069
dbEST ID: 79655771
Trimmed Sequence: ATGGCGGCAGCTGCGGAGGGTTTCCTGGGCCTGCTCCTAAGTTTCTCCCTCCTTCATGGAATTCAATCCTTCTATGTTCCTGGTGTTGCACCTATTAACTTCCTCCAGGATGCCCCTGTGGACATAAAGGCTGTGAAGCTCACCAGTTCCCGTACACAGCTGCCATATGAGTACTACTCACTGCCCTTCTGCCAGCCTCCTGAGATCACCTACAAGTCAGAGAATCTGGGTGAGGTCCTACGTGGGGATCGAATTGTTAACACTCCTTTCCGAGTTCTTATGAACAGTGATAAAAAGTGTGAGGTTGTGTGCGGGAGTCCGAGCAAACCCCATGTGCTGAATGTGGAACAGAGCAAGCTGATGGCAGAGCGCATTCGGGAGGACTATTATGTTCACCTGATAGCGGATAACCTGCCTGTGGCCACTAGACTGGATCTCTATTTAAACCGCGAGGAGGAGGATAAGAAGAAAGAAAAGGATGTTCAGTTTGAACATGGCTACCGTCTTGGCTTCACTGACAACAACAAGTTCTACCTGCACAATCACCTGTCCTTCTATTTATATTCTCACCGGGAAGAAGTGGAAGAGAAACAGGAGCCCACCTATAGGGTAGTGAGATTTGAGGTCATTCCCCAGAGCATCCCATTGGAAGATCTGAAAGGGAACAATCAGGGTTCATGTACCGTCCCTGAAAACTCCACTTCTCCCCCCCAGAGATTGATCCTTCCAAGAAAACAACATTGTTTTT
Full Trace Sequence: TCGTGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCAGCTGCGGAGGGTTTCCTGGGCCTGCTCCTAAGTTTCTCCCTCCTTCATGGAATTCAATCCTTCTATGTTCCTGGTGTTGCACCTATTAACTTCCTCCAGGATGCCCCTGTGGACATAAAGGCTGTGAAGCTCACCAGTTCCCGTACACAGCTGCCATATGAGTACTACTCACTGCCCTTCTGCCAGCCTCCTGAGATCACCTACAAGTCAGAGAATCTGGGTGAGGTCCTACGTGGGGATCGAATTGTTAACACTCCTTTCCGAGTTCTTATGAACAGTGATAAAAAGTGTGAGGTTGTGTGCGGGAGTCCGAGCAAACCCCATGTGCTGAATGTGGAACAGAGCAAGCTGATGGCAGAGCGCATTCGGGAGGACTATTATGTTCACCTGATAGCGGATAACCTGCCTGTGGCCACTAGACTGGATCTCTATTTAAACCGCGAGGAGGAGGATAAGAAGAAAGAAAAGGATGTTCAGTTTGAACATGGCTACCGTCTTGGCTTCACTGACAACAACAAGTTCTACCTGCACAATCACCTGTCCTTCTATTTATATTCTCACCGGGAAGAAGTGGAAGAGAAACAGGAGCCCACCTATAGGGTAGTGAGATTTGAGGTCATTCCCCAGAGCATCCCATTGGAAGATCTGAAAGGGAACAATCAGGGTTCATGTACCGTCCCTGAAAACTCCACTTCTCCCCCCCAGAGATTGATCCTTCCAAGAAAACAACATTGTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCAGCTGCGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838068
dbEST ID: 79655770
Trimmed Sequence: GTCTATTTTCACAGCTGCATAGATCTTACGGATAAACATGTAGGCAGCGTAGAAGCCGATGGTGCCAGTGAGAAGCCAGAAGGACAACACCATAAGAGCCGTGTATCCGAAATAGAGGAGGGATGGGATAAACTCCACAATGTCCAACTTATTAACAAAGTAGAAGACAGCATAGATTAGAACGTAAAATGCAGAACCGCCAGACACCAGAAACGTTCTCCACCACCAGCGATAATCCTCGGCACACAGCTGAAAGTAGACCATGACAATGCTGATTTGGGAACAAGACACCACAAGGATAATAAATACGAGGAAGAGGAAGCCAAACAGATAGTAGAACTGATTCTCCCAAATGGCACTGAAGATAAAGAAGAGTTCGATGAACATGGCCCCAAAGGGAAGGATTCCAGCCATCAGGATCCCAACAAATCTCTTCATGTACCAACGTTGCTCTGGAATTTGCCTTGGGATCTGATTGGTTCGCACAGGGTTATCATATGGCTGCTTCCTGAACCCAAAGTAGTAGCCCAGGTACACCAGGGGCAGAGAGATTCCAAACCACATGCACAGCAGGGCAACCATGGTGGGGAACGGCACCGCCCCAGAGGAATGTTTCCCCCAGATAAAACAGTTTAGCACAAAACAGATTCCGAGCACCACTCCTGGGTACAGCGTAGCCGTACAAAAATGCCCCTTTCCCGCCTTCGGTGGGCCCTTTTAGGGGTCCGATTAAAAAAGCCCCAGACCAAAAAAATCCTT
Full Trace Sequence: GGGGAAACTGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTATTTTCACAGCTGCATAGATCTTACGGATAAACATGTAGGCAGCGTAGAAGCCGATGGTGCCAGTGAGAAGCCAGAAGGACAACACCATAAGAGCCGTGTATCCGAAATAGAGGAGGGATGGGATAAACTCCACAATGTCCAACTTATTAACAAAGTAGAAGACAGCATAGATTAGAACGTAAAATGCAGAACCGCCAGACACCAGAAACGTTCTCCACCACCAGCGATAATCCTCGGCACACAGCTGAAAGTAGACCATGACAATGCTGATTTGGGAACAAGACACCACAAGGATAATAAATACGAGGAAGAGGAAGCCAAACAGATAGTAGAACTGATTCTCCCAAATGGCACTGAAGATAAAGAAGAGTTCGATGAACATGGCCCCAAAGGGAAGGATTCCAGCCATCAGGATCCCAACAAATCTCTTCATGTACCAACGTTGCTCTGGAATTTGCCTTGGGATCTGATTGGTTCGCACAGGGTTATCATATGGCTGCTTCCTGAACCCAAAGTAGTAGCCCAGGTACACCAGGGGCAGAGAGATTCCAAACCACATGCACAGCAGGGCAACCATGGTGGGGAACGGCACCGCCCCAGAGGAATGTTTCCCCCAGATAAAACAGTTTAGCACAAAACAGATTCCGAGCACCACTCCTGGGTACAGCGTAGCCGTACAAAAATGCCCCTTTCCCGCCTTCGGTGGGCCCTTTTAGGGGTCCGATTAAAAAAGCCCCAGACCAAAAAAATCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTATTTTCACAGCTGCATAGAT