ORFeome > tma16 ORF1 – XORFeome v1.0

tma16 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tma16
Gene ID: 1015323
Gene Page ID: 1015316
ORF Xenbase ID: 17301021

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097807
Original XGC clone length: 591

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ838425
dbEST ID: 79656127
Trimmed Sequence: ATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAGAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAANATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTT
Full Trace Sequence: CGAGGCCCCATATAAGTGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCAAAGTCCAATCAAATAAAAGCAAGCAAGAAAAAGTTATTCATCCGTACAGCAGGAAAGCTGCTCAGCTCACAAGAGAAGCCCACAAGCAAGACAGAAAGGATAGGTTAAAAAGTGAAAAAGCTCTGCGCCTAAGCATTATTGGTGAAAAACTGCAGTGGTTTCAAAGCCATCTAAATCCTGAAAAAGCAGAATACACAAAGAAGGAAGCCTGTGAACTAATTGAAAGTTACTTACATCGGTTTGATAATGAATTGGAACAAATTGAATTGCACAACAGTATCAAAGGAAGACAAACAAGACGGCATGAATCTCGTGAGACTGTTATCAAGCAGACCATAGAGCGTGAAAGGCAACTATACAATGGATATGGAATAGAAATACCAGATATTGTGAATTCCAGAAATCTGAAAGTGTTCAGGGATTGGGATTTAGATATGAAGAAACTGCCGAATATCAGAATGCGAAAAATTTCAATCAGCGATTCACTTTCCAAAAGTGATAAAGATGTTCCAGGCAGCAATGATGAAATAGAANATGAACTTGGATCTAATGAGGAATCCATGCCTGATTTTCAAGAAAGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAGTTTGTTGCAACGAAACAGGCACT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCAAAGTCCAATCAAATAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838424
dbEST ID: 79656126
Trimmed Sequence: ACTTTCTTGAAAATCAGGCATGGATTCCTCATTAGATCCAAGTTCATTTTCTATTTCATCATTGCTGCCTGGAACATCTTTATCACTTTTGGAAAGTGAATCGCTGATTGAAATTTTTCGCATTTTGATATTCGGCAGTTTCTTCATATCTAAATCCCAATCCCTGAACACTTTCAGATTTCTGGAATTCACAATATCTGGTATTTCTATTCCATATCCATTGTATAGTTGCCTTTCACGCTCTATGGTCTGCTTGATAACAGTCTCACGAGATTCATGCCGTCTTGTTTGTCTTCCTTTGATACTGTTGTGCAATTCAATTTGTTCCAATTCATTATCAAACCGATGTAAGTAACTTTCAATTAGTTCACACGCTTCCTTCTTTGTGTATTCTGCTTTTTCAAGATTTATATGGCTTTTAAACCACTGCAGTGTTTCACCAATAATGCTTATGCACAGAACTTTTTCCCTTTGTAACCTATACTTTCTGTCTAGCGGCTGGGGCTGGCGTGTGAACAGAACAAGCTGGGCGGCCTTACGGATAGAGAAATTGTTGGTGGGGTGATGTGTGGAGATTATAGTGTAGAAAAAGGGGGCGGCTTTTTTATGACGCCGGGGGGGGTAGGGAAAAGGAAAAAAATAGTAGGTTGGTGGGGAGGGGGAGGAGGGG
Full Trace Sequence: GGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTTTCTTGAAAATCAGGCATGGATTCCTCATTAGATCCAAGTTCATTTTCTATTTCATCATTGCTGCCTGGAACATCTTTATCACTTTTGGAAAGTGAATCGCTGATTGAAATTTTTCGCATTTTGATATTCGGCAGTTTCTTCATATCTAAATCCCAATCCCTGAACACTTTCAGATTTCTGGAATTCACAATATCTGGTATTTCTATTCCATATCCATTGTATAGTTGCCTTTCACGCTCTATGGTCTGCTTGATAACAGTCTCACGAGATTCATGCCGTCTTGTTTGTCTTCCTTTGATACTGTTGTGCAATTCAATTTGTTCCAATTCATTATCAAACCGATGTAAGTAACTTTCAATTAGTTCACACGCTTCCTTCTTTGTGTATTCTGCTTTTTCAAGATTTATATGGCTTTTAAACCACTGCAGTGTTTCACCAATAATGCTTATGCACAGAACTTTTTCCCTTTGTAACCTATACTTTCTGTCTAGCGGCTGGGGCTGGCGTGTGAACAGAACAAGCTGGGCGGCCTTACGGATAGAGAAATTGTTGGTGGGGTGATGTGTGGAGATTATAGTGTAGAAAAAGGGGGCGGCTTTTTTATGACGCCGGGGGGGGTAGGGAAAAGGAAAAAAATAGTAGGTTGGTGGGGAGGGGGAGGAGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTTTCTTGAAAATCAGGCATGG