ORFeome > tmed10 ORF1 – XORFeome v1.0

tmed10 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tmed10
Gene ID: 5756729
Gene Page ID: 5756690
ORF Xenbase ID: 17301063

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054154
Original XGC clone length: 618

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ839152
dbEST ID: 79656854
Trimmed Sequence: ATGATGTGGCTCCTGCTTTTCCTTGGCCCTTGTTTCTTATTGCCCGGGACCGGGGCGATCTCTTTTTATTTGCGCCCTCTCACTAAAAAGTGCCTGAAAGAAGAAATCCATAAAGATGTGTTGGTGACTGGACAGTATGAGGTGTCTGAGCAGCCCGGTCTCACTTGCGACCTGAAGGTGACTGACTCCATCGGCCATATTCTTTATTCCAAGGAAGAAGCAAAGAAGGGAAAATTTGCATTTACTACTGATGATTATGATGTGTATGAAGTCTGCTTTGAGAGCAAATCTGCATCTGATATGGGTTTCACAGACCAGTTAATTGTCCTTGATATAAAGCACGGTGTGGAAGCAAAGAATTATGAAGACGTTGCCAAGACAGAGAAGCTGAAACCACTTGAAGTTGAGCTTAGACGTTTGGAGGATTTGACACATTCGGTTGTGAAGGACTTTTCCTATATGAAAAAAAGAGAAGAAGAAATGAGGGACACTAACGAATCCACCAGTCTTCGTGTCCTCTACTTTAGCATGTTCTCCATGTTTTGCCTTGTGGCCCTTGCTACGTGGCAAGTCTGTTACTTAAGGCATTTTTTCAAGGCAAAGAAACTTAAGGAAGTT
Full Trace Sequence: GGCGATCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGTGGCTCCTGCTTTTCCTTGGCCCTTGTTTCTTATTGCCCGGGACCGGGGCGATCTCTTTTTATTTGCGCCCTCTCACTAAAAAGTGCCTGAAAGAAGAAATCCATAAAGATGTGTTGGTGACTGGACAGTATGAGGTGTCTGAGCAGCCCGGTCTCACTTGCGACCTGAAGGTGACTGACTCCATCGGCCATATTCTTTATTCCAAGGAAGAAGCAAAGAAGGGAAAATTTGCATTTACTACTGATGATTATGATGTGTATGAAGTCTGCTTTGAGAGCAAATCTGCATCTGATATGGGTTTCACAGACCAGTTAATTGTCCTTGATATAAAGCACGGTGTGGAAGCAAAGAATTATGAAGACGTTGCCAAGACAGAGAAGCTGAAACCACTTGAAGTTGAGCTTAGACGTTTGGAGGATTTGACACATTCGGTTGTGAAGGACTTTTCCTATATGAAAAAAAGAGAAGAAGAAATGAGGGACACTAACGAATCCACCAGTCTTCGTGTCCTCTACTTTAGCATGTTCTCCATGTTTTGCCTTGTGGCCCTTGCTACGTGGCAAGTCTGTTACTTAAGGCATTTTTTCAAGGCAAAGAAACTTAAGGAAGTTGCCAACTTTCTTGGTACAAGGTTGGCATTATAAAAAAAGCAATGGCTAATTAATTTGTTGCAACCAACAAGGTCACTATCAATCAAAAAAAAATCCTTAATTGGCCATCCAGCCTGAAAACCCCCTAAAATTGAATCCAAAAAAAAAAAAAAAAAAAAATTGATTACCCTGGAACAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGTGGCTCCTGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839151
dbEST ID: 79656853
Trimmed Sequence: CTCAATAAGTTTCTTTGCCTTGAAAAAATGCCTTAAGTAACAGACTTGCCACGTAGCAAGGGCCACAAGGCAAAACATGGAGAACATGCTAAAGTAGAGGACACGAAGACTGGTGGATTCGTTAGTGTCCCTCATTTCTTCTTCTCTTTTTTTCATATAGGAAAAGTCCTTCACAACCGAATGTGTCAAATCCTCCAAACGTCTAAGCTCAACTTCAAGTGGTTTCAGCTTCTCTGTCTTGGCAACGTCTTCATAATTCTTTGCTTCCACACCGTGCTTTATATCAAGGACAATTAACTGGTCTGTGAAACCCATATCAGATGCAGATTTGCTCTCAAAGCAGACTTCATACACATCATAATCATCAGTAGTAAATGCAAATTTTCCCTTCTTTGCTTCTTCCTTGGAATAAAGAATATGGCCGATGGAGTCAGTCACCTTCAGGTCGCAAGTGAGACCGGGCTGCTCAGACACCTCATACTGTCCAGTCACCAACACATCTTTATGGATTTCTTCTTTCAGGCACTTTTTAGTGAGAGGGCGCAAATAAAAAGAGATCGCCCCCGGTCCCGGGCAATAAGAAACAAAGGGCCAAAGGAAAAGCAGGAACCCACATACATGGTTGCCAACTTTTTTTTGTACAAAGTTGGCCATAAAAAAAAAACCATTGCCTCATTCAATTTTGTTGGCAACGGAAACAGGTTCACTAATCCAGTCAAAAATAAAAAATCAATAAATT
Full Trace Sequence: GCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAATAAGTTTCTTTGCCTTGAAAAAATGCCTTAAGTAACAGACTTGCCACGTAGCAAGGGCCACAAGGCAAAACATGGAGAACATGCTAAAGTAGAGGACACGAAGACTGGTGGATTCGTTAGTGTCCCTCATTTCTTCTTCTCTTTTTTTCATATAGGAAAAGTCCTTCACAACCGAATGTGTCAAATCCTCCAAACGTCTAAGCTCAACTTCAAGTGGTTTCAGCTTCTCTGTCTTGGCAACGTCTTCATAATTCTTTGCTTCCACACCGTGCTTTATATCAAGGACAATTAACTGGTCTGTGAAACCCATATCAGATGCAGATTTGCTCTCAAAGCAGACTTCATACACATCATAATCATCAGTAGTAAATGCAAATTTTCCCTTCTTTGCTTCTTCCTTGGAATAAAGAATATGGCCGATGGAGTCAGTCACCTTCAGGTCGCAAGTGAGACCGGGCTGCTCAGACACCTCATACTGTCCAGTCACCAACACATCTTTATGGATTTCTTCTTTCAGGCACTTTTTAGTGAGAGGGCGCAAATAAAAAGAGATCGCCCCCGGTCCCGGGCAATAAGAAACAAAGGGCCAAAGGAAAAGCAGGAACCCACATACATGGTTGCCAACTTTTTTTTGTACAAAGTTGGCCATAAAAAAAAAACCATTGCCTCATTCAATTTTGTTGGCAACGGAAACAGGTTCACTAATCCAGTCAAAAATAAAAAATCAATAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAATAAGTTTCTTTGCCTTGAA