ORFeome > tmed2 ORF1 – XORFeome v1.0

tmed2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmed2
Gene ID: 986357
Gene Page ID: 986352
ORF Xenbase ID: 17301069

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044095
Original XGC clone length: 606

Human orthology & disease relationships

NCBI Entrez ID: 10959
Ensembl gene IDs: ENSG00000086598
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 243800,607689,607692

Library Location

Plate ID: GDExl11008
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ823622
dbEST ID: 79641324
Trimmed Sequence: ATGTTCACGCTTTCTGAACTCGTGACCCTGCTCGCTTTCTTTTCCGCCACGGCGTCTGGTTATTTTGTCAGCATAGACGCTCACGCGGAAGAATGCTTCTTCGAGCAGGTCACGTCGGGTACCAAGATGGGCCTTATTTTTGAGGTGGCGGAGGGGGGATTTCTGGACATCGACGTAGAGATTACAGGTCCAGACAACAAAGGCATATATAAAGGAGACAGAGAGTCCAGTGGAAAATACACGTTTGCAGCCCACATGGATGGAACATACAAATTCTGTTTTAGCAATAGGATGTCCACAATGACTCCTAAGATTGTAATGTTTACTATTGATATAGGAGAAGCCCCGAAAGGTCAAGACATGGAAACAGAAGCACATCAAAACAAGCTGGAAGAAATGATCAATGAACTGGCTGTAGCCATGACTGCTGTGAAGCATGAACAGGAATACATGGAGGTGCGAGAGAGAATACACAGAGCAATTAACGACAACACAAACAGCAGAGTAGTGCTTTGGTCATTTTTTGAAGCCCTTGTACTTGTTGCGATGACATTGGGACAGATCTATTATCTAAAGAGATTTTTTGAAGTGCGACGAGTGGTTCTG
Full Trace Sequence: TGCCATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCACGCTTTCTGAACTCGTGACCCTGCTCGCTTTCTTTTCCGCCACGGCGTCTGGTTATTTTGTCAGCATAGACGCTCACGCGGAAGAATGCTTCTTCGAGCAGGTCACGTCGGGTACCAAGATGGGCCTTATTTTTGAGGTGGCGGAGGGGGGATTTCTGGACATCGACGTAGAGATTACAGGTCCAGACAACAAAGGCATATATAAAGGAGACAGAGAGTCCAGTGGAAAATACACGTTTGCAGCCCACATGGATGGAACATACAAATTCTGTTTTAGCAATAGGATGTCCACAATGACTCCTAAGATTGTAATGTTTACTATTGATATAGGAGAAGCCCCGAAAGGTCAAGACATGGAAACAGAAGCACATCAAAACAAGCTGGAAGAAATGATCAATGAACTGGCTGTAGCCATGACTGCTGTGAAGCATGAACAGGAATACATGGAGGTGCGAGAGAGAATACACAGAGCAATTAACGACAACACAAACAGCAGAGTAGTGCTTTGGTCATTTTTTGAAGCCCTTGTACTTGTTGCGATGACATTGGGACAGATCTATTATCTAAAGAGATTTTTTGAAGTGCGACGAGTGGTTCTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTTGCACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGCATCCCGGTGATATCCCCCTATGGTGAGTTGAATTAAGGGGCCAAAGCTGTTTTCCGGGGCGCTCTTGGCCCGGGGCTAAAAAAAAAAAATAAAAGATTACAAAGAAAAANGATAAAGAGGGAGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCACGCTTTCTGAACTC

Sequences - 3ʹ (reverse) EST

Accession: JZ828923
dbEST ID: 79646625
Trimmed Sequence: AACCACTCGTCGCACTTCAAAAAATCTCTTTAGATAATAGATCTGTCCCAATGTCATCGCAACAAGTACAAGGGCTTCAAAAAATGACCAAAGCACTACTCTGCTGTTTGTGTTGTCGTTAATTGCTCTGTGTATTCTCTCTCGCACCTCCATGTATTCCTGTTCATGCTTCACAGCAGTCATGGCTACAGCCAGTTCATTGATCATTTCTTCCAGCTTGTTTTGATGTGCTTCTGTTTCCATGTCTTGACCTTTCGGGGCTTCTCCTATATCAATAGTAAACATTACAATCTTAGGAGTCATTGTGGACATCCTATTGCTAAAACAGAATTTGTATGTTCCATCCATGTGGGCTGCAAACGTGTATTTTCCACTGGACTCTCTGTCTCCTTTATATATGCCTTTGTTGTCTGGACCTGTAATCTCTACGTCGATGTCCAGAAATCCCCCCTCCGCCACCTCAGAAATAAGGCCCATCTTGGTACCCGACGTGACCTGCTCGAAGAAGCATTCTTCCGCGTGAGCGTCTATGCTGACAAAATAACCAGACGCCGTGGCGGATAAGAAAGCGAGCAGGGTCACGAGTTCAGAAAGCGTGAACATGGTGGCCACTTT
Full Trace Sequence: GGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACCACTCGTCGCACTTCAAAAAATCTCTTTAGATAATAGATCTGTCCCAATGTCATCGCAACAAGTACAAGGGCTTCAAAAAATGACCAAAGCACTACTCTGCTGTTTGTGTTGTCGTTAATTGCTCTGTGTATTCTCTCTCGCACCTCCATGTATTCCTGTTCATGCTTCACAGCAGTCATGGCTACAGCCAGTTCATTGATCATTTCTTCCAGCTTGTTTTGATGTGCTTCTGTTTCCATGTCTTGACCTTTCGGGGCTTCTCCTATATCAATAGTAAACATTACAATCTTAGGAGTCATTGTGGACATCCTATTGCTAAAACAGAATTTGTATGTTCCATCCATGTGGGCTGCAAACGTGTATTTTCCACTGGACTCTCTGTCTCCTTTATATATGCCTTTGTTGTCTGGACCTGTAATCTCTACGTCGATGTCCAGAAATCCCCCCTCCGCCACCTCAGAAATAAGGCCCATCTTGGTACCCGACGTGACCTGCTCGAAGAAGCATTCTTCCGCGTGAGCGTCTATGCTGACAAAATAACCAGACGCCGTGGCGGATAAGAAAGCGAGCAGGGTCACGAGTTCAGAAAGCGTGAACATGGTGGCCACTTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGCAAGAAAAGGGGCCCAGACAGTCAAAAAAAAAATAACATTAATTTGGGGGGCGGAGCTTAGACCTGCCTAGAAACTAAAAAAATCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACCACTCGTCGCACTTCA