ORFeome > tmed5 ORF1 – XORFeome v1.0

tmed5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmed5
Gene ID: 6078044
Gene Page ID: 951291
ORF Xenbase ID: 17301081

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123278
Original XGC clone length: 675

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ838752
dbEST ID: 79656454
Trimmed Sequence: ATGGGGAAGGAAGCAGTGCTGTTCCTGATGCTGCTCATCCACTACACAGTGCGGCACTGCCTGGGCTTCTCCCAGTCTGTGGATAGCGATTATACCTTTACCCTCCCCGCGGGGCACAAGGAGTGTTTCTTTCAGCCCATGAAGAAGGATGCCACTCTGGAGATCGAGTATCAGGTGTTGGATGGTGCTGGTTTAGATGTGGGTTTTTCTCTCATATCTCCNGATGGTGAACTTCTACTGTCAAAGGAACGGCAGTCAGACGGGGTTCACTCGGTAGAGACAGTTGACGGCGATTACCAGTTCTGCTTTGACAATACCTTCATCCGTATGTCTGAGAAAGTGATCTTTTTTGAATTGATCTTAGATCACTTGAATGATGAACGAAACGAACAAGAGGACTGGAAGAATTATATTATGGGCACACATCTGCTGGACATGAATCTGGAGGATAACCTGGAAACTATTAACATTGTTAGATGGTCGATTAACCAAAAGTGCCCAGAATCCAACACTTGAAAAAGCCTTTTAATCTTCTAGATCCAACCTTCACGAAAGAAGTTTAAAAGAATAACCTTTTTTTCTGGTTTGACTTTGTGGGTGGTGGTGTTGGGGTGTGGTCTGCGAGTCTTGATAGTCCAATATAAGTGATATGGAGCGTTAGAGAGGGAGGGAGTGTCAACCTTTGATAGATGAGGTTGTTGATGTGAAAGAAAAATTCCGATGGTTGTTTTATTTAGATGTGTGTAGAGAAATGCAAAAAAAAAATAAGTATAATATTATATTAGATGACCGGTTAGGGTGCCTAAAAAAAAAAAAAA
Full Trace Sequence: CTCGAGGGCCACATAATGATTTTATTTTGACTGATAGTGNACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAAGGAAGCAGTGCTGTTCCTGATGCTGCTCATCCACTACACAGTGCGGCACTGCCTGGGCTTCTCCCAGTCTGTGGATAGCGATTATACCTTTACCCTCCCCGCGGGGCACAAGGAGTGTTTCTTTCAGCCCATGAAGAAGGATGCCACTCTGGAGATCGAGTATCAGGTGTTGGATGGTGCTGGTTTAGATGTGGGTTTTTCTCTCATATCTCCNGATGGTGAACTTCTACTGTCAAAGGAACGGCAGTCAGACGGGGTTCACTCGGTAGAGACAGTTGACGGCGATTACCAGTTCTGCTTTGACAATACCTTCATCCGTATGTCTGAGAAAGTGATCTTTTTTGAATTGATCTTAGATCACTTGAATGATGAACGAAACGAACAAGAGGACTGGAAGAATTATATTATGGGCACACATCTGCTGGACATGAATCTGGAGGATAACCTGGAAACTATTAACATTGTTAGATGGTCGATTAACCAAAAGTGCCCAGAATCCAACACTTGAAAAAGCCTTTTAATCTTCTAGATCCAACCTTCACGAAAGAAGTTTAAAAGAATAACCTTTTTTTCTGGTTTGACTTTGTGGGTGGTGGTGTTGGGGTGTGGTCTGCGAGTCTTGATAGTCCAATATAAGTGATATGGAGCGTTAGAGAGGGAGGGAGTGTCAACCTTTGATAGATGAGGTTGTTGATGTGAAAGAAAAATTCCGATGGTTGTTTTATTTAGATGTGTGTAGAGAAATGCAAAAAAAAAATAAGTATAATATTATATTAGATGACCGGTTAGGGTGCCTAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAAGGAAGCAGTGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838751
dbEST ID: 79656453
Trimmed Sequence: GAGCCTACTTTTCCTTTTGTCCTCAAAAATACTTCTTAGCATATAGACTTGCAGAGCAGACACCACAACCATCACCACCAAGTTGAAAACAGACCAAAAGTTCACTCTTTCACAATTACTCTCCTGAAGGTTGCGATCTCGAGCTTCAAAGGCTTTTAGCAGTGTCTGGATCTGGGCACTTTTGGTTAATCGACCTTTAACACTGTTAATAGTTTCCAGGATATCCTCCAGCTTCATGTCCAGCAGATCTGTGCCCATAATATAATTCTTCCAGTCCTCTTGTTCGTTTCCTTCATCATTCAAGTGATCTAAGATCAATTCAAAAAAGATCACTTTCTCAGACATACGGCTGAAGGTATTGTCAAAGCAGAACTGGTAATCGCCGTCAACTGTCTCTACCGAGTGAACCCCGTCTGACTGCCGTTCCTCTGACAGTAGAAGTTCACCATCCGGAGATATGAGAGAAAAACCCACATCTAAACCAGCACCATCCAACACCTGATACTCGATCTCCAGAGTGGCATCCTTCTTCATGGGCTGAGAGAGACACTCCTTGTGCCCCGCGGGGAGGGTAAAGGTATAATCGCTATCCACAGACTGGGGAAAGCCCAGGCAGTGCCGCACCGGTGTAGTGGATAAACAGCAACAAGAACAGCACTGCTTCCCTCCCCAGGGGTCCCACTTTTTTTGTTCCAATTGGCAATAAAAAAAAAACATTGCCCAAGCAATTTGTTTTGAAAGAAAAAAAGAAAAAAAAAAAAAAATAAAA
Full Trace Sequence: AAGATGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGCCTACTTTTCCTTTTGTCCTCAAAAATACTTCTTAGCATATAGACTTGCAGAGCAGACACCACAACCATCACCACCAAGTTGAAAACAGACCAAAAGTTCACTCTTTCACAATTACTCTCCTGAAGGTTGCGATCTCGAGCTTCAAAGGCTTTTAGCAGTGTCTGGATCTGGGCACTTTTGGTTAATCGACCTTTAACACTGTTAATAGTTTCCAGGATATCCTCCAGCTTCATGTCCAGCAGATCTGTGCCCATAATATAATTCTTCCAGTCCTCTTGTTCGTTTCCTTCATCATTCAAGTGATCTAAGATCAATTCAAAAAAGATCACTTTCTCAGACATACGGCTGAAGGTATTGTCAAAGCAGAACTGGTAATCGCCGTCAACTGTCTCTACCGAGTGAACCCCGTCTGACTGCCGTTCCTCTGACAGTAGAAGTTCACCATCCGGAGATATGAGAGAAAAACCCACATCTAAACCAGCACCATCCAACACCTGATACTCGATCTCCAGAGTGGCATCCTTCTTCATGGGCTGAGAGAGACACTCCTTGTGCCCCGCGGGGAGGGTAAAGGTATAATCGCTATCCACAGACTGGGGAAAGCCCAGGCAGTGCCGCACCGGTGTAGTGGATAAACAGCAACAAGAACAGCACTGCTTCCCTCCCCAGGGGTCCCACTTTTTTTGTTCCAATTGGCAATAAAAAAAAAACATTGCCCAAGCAATTTGTTTTGAAAGAAAAAAAGAAAAAAAAAAAAAAATAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGCCTACTTTTCCTTTTGTCC