ORFeome > tmed9 ORF1 – XORFeome v1.0

tmed9 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tmed9
Gene ID: 6077926
Gene Page ID: 944837
ORF Xenbase ID: 17301105

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC082910
Original XGC clone length: 429

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ839878
dbEST ID: 79657580
Trimmed Sequence: ATGAAGGTCATTCTCTCTCGCCAGTATGGCTCTGAAGGACGTTTCACTTTTACTTCTCATACTCCTGGAGAGCATCAGATCTGTCTGCATTCTAACTCCACTAAGTTTGCCCTCTTTGCTGGAGGTATGCTGCGAGTTCACCTTGATATCCAGGTTGGGGAGCATGCCAATGATTATGTGGATATTGCTGCCAAGGACAAGCTAAACACATTACAATTACGTGTCAGGCAACTCGTAGAGCAAGTGGAACAGATTCAGAAGGAACAGAATTACCAGAGATGGCGAGAGGAGAGGTTCCGACAGACAAGTGACAGCACCAGTCAGCGGGTCCTTTGGTGGTCCATCGCTCAGACTTTAATCCTAGTGACTATTGGCGTTTGGCAGATGAAACATCTAAAGGGCTTCTTTGAAGCGAAGAAACTTGTATT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGTCATTCTCTCTCGCCAGTATGGCTCTGAAGGACGTTTCACTTTTACTTCTCATACTCCTGGAGAGCATCAGATCTGTCTGCATTCTAACTCCACTAAGTTTGCCCTCTTTGCTGGAGGTATGCTGCGAGTTCACCTTGATATCCAGGTTGGGGAGCATGCCAATGATTATGTGGATATTGCTGCCAAGGACAAGCTAAACACATTACAATTACGTGTCAGGCAACTCGTAGAGCAAGTGGAACAGATTCAGAAGGAACAGAATTACCAGAGATGGCGAGAGGAGAGGTTCCGACAGACAAGTGACAGCACCAGTCAGCGGGTCCTTTGGTGGTCCATCGCTCAGACTTTAATCCTAGTGACTATTGGCGTTTGGCAGATGAAACATCTAAAGGGCTTCTTTGAAGCGAAGAAACTTGTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTAAAAAAAAAAAAAAAAAAAATATAAAATAATAATAATTTTTCAAAAACCCGCGCGGGGGAAAAAAAAAAAACCCCTCTCCCCCCTCCCCGGCGGGGGTGTTTGGGTTTAAAAAAGTAAAGAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAACGGCGGTTGTGTGTTGTGAAAAAAAGGAGAGGAAGGGGGGGACCCCCCCCCCCCCCCCCCCCCACCCCACCCCAACCGACGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGTCATTCTCTCTCGCCA

Sequences - 3ʹ (reverse) EST

Accession: JZ839877
dbEST ID: 79657579
Trimmed Sequence: TACAAGTTTCTTCGCTTCAAAGAAGCCCTTTAGATGTTTCATCTGCCAAACGCCAATAGTCACTAGGATTAAAGTCTGAGCGATGGACCACCAAAGGACCCGCTGACTGGTGCTGTCACTTGTCTGTCGGAACCTCTCCTCTCGCCATCTCTGGTAATTCTGTTCCTTCTGAATCTGTTCCACTTGCTCTACGAGTTGCCTGACACGTAATTGTAATGTGTTTAGCTTGTCCTTGGCAGCAATATCCACATAATCATTGGCATGCTCCCCAACCTGGATATCAAGGTGAACTCGCAGCATACCTCCNGCAAAGAGGGCAAACTTAGTGGAGTTAGAATGCAGACAGATCTCATGCTCTCCAGGAGTATGAGAAGTAAAAGTGAAACGTCCTTCAGAGCCATACTGGCGAGAGAGAATGACCTTCATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACAAGTTTCTTCGCTTCAAAGAAGCCCTTTAGATGTTTCATCTGCCAAACGCCAATAGTCACTAGGATTAAAGTCTGAGCGATGGACCACCAAAGGACCCGCTGACTGGTGCTGTCACTTGTCTGTCGGAACCTCTCCTCTCGCCATCTCTGGTAATTCTGTTCCTTCTGAATCTGTTCCACTTGCTCTACGAGTTGCCTGACACGTAATTGTAATGTGTTTAGCTTGTCCTTGGCAGCAATATCCACATAATCATTGGCATGCTCCCCAACCTGGATATCAAGGTGAACTCGCAGCATACCTCCNGCAAAGAGGGCAAACTTAGTGGAGTTAGAATGCAGACAGATCTCATGCTCTCCAGGAGTATGAGAAGTAAAAGTGAAACGTCCTTCAGAGCCATACTGGCGAGAGAGAATGACCTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCCNACCTAAAATAAAAAAAAAAAATAAAACACAAAATAAAAATGGGCGAGCTCCCCGCCGCGGGGAGGAAAAAAATCCTTTCTTCTTCGCCCCCCGCTGGTTTGTTGTGTGAAAAAACATAGGGGAAGGAGGAAGAAGAAACAAAGCAAAAAAAAAAAAGAACAGAGTTTGGTGGTTGTATTTTTGTAATATAGAAGAAGGGGGCCCGCCCCCCCCCANAGCGGGCGAAAACACAGCACAAAGACAAAAGGCCGAGCGGGGGGGGGGGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACAAGTTTCTTCGCTTCAAAGAA