ORFeome > tmeff2 ORF1 – XORFeome v1.0

tmeff2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmeff2
Gene ID: 6252442
Gene Page ID: 854442
ORF Xenbase ID: 17301111

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123167
Original XGC clone length: 1053

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ838184
dbEST ID: 79655886
Trimmed Sequence: ATGGCTGGAGAAGCCCATAGACTGCGCCGTAACCGGCTCTGCTCGCTCATTTTACCGGCACTGCTGCTGCTGACCGTCGCCTGGCCGACACAGCTTGTGGCTTTTCCGACCTCCCTTAGCGACTGCCAAACGCCCACAGGCTGGAACTGTTCCGGTTTTGATGACAAAGAAAACGATCTCTTTCTTTGTGACACCAATACATGTAAATTTGATGGTGAGTGTTTAAGAATTGGAGACAGTGTAACCTGCGATTGCCAGTTCAAGTGTCCCCATGATTACATCCCAGTTTGTGGCTCCAATGGTGTCACTTTTCGCAATGAATGCTACCTAAGAGGCGCTGCCTGCAAACAACAGAGTGAAATACTTGTAGTTTCTGAAGGATCCTGTATAGCAGATGGTGGATCTGGCTCAGGTGATGGAGTGAATGAAGGCTCTGGGGAAACAGTCCAAAAAGAGACATCTACTTGTGACATATGCCAGTTTGGAGCAGAATGTGATGAGGATGCAGAAGATGTGTGGTGCGTATGTAACATTGACTGTTCACATATCAGCTTCAATCCGGTCTGTGCTTCAGATGGGAAATCCTATGACAATCCATGTCAAATCAAAGAAGCTTCATGTCAGAGACAGGAAAAAATTGAAGTCAAATATTTTGGGTCGATGTTCAGAAATACTACAGAAAATACAAAATCTGAAGACAGTCT
Full Trace Sequence: GTACGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGAGAAGCCCATAGACTGCGCCGTAACCGGCTCTGCTCGCTCATTTTACCGGCACTGCTGCTGCTGACCGTCGCCTGGCCGACACAGCTTGTGGCTTTTCCGACCTCCCTTAGCGACTGCCAAACGCCCACAGGCTGGAACTGTTCCGGTTTTGATGACAAAGAAAACGATCTCTTTCTTTGTGACACCAATACATGTAAATTTGATGGTGAGTGTTTAAGAATTGGAGACAGTGTAACCTGCGATTGCCAGTTCAAGTGTCCCCATGATTACATCCCAGTTTGTGGCTCCAATGGTGTCACTTTTCGCAATGAATGCTACCTAAGAGGCGCTGCCTGCAAACAACAGAGTGAAATACTTGTAGTTTCTGAAGGATCCTGTATAGCAGATGGTGGATCTGGCTCAGGTGATGGAGTGAATGAAGGCTCTGGGGAAACAGTCCAAAAAGAGACATCTACTTGTGACATATGCCAGTTTGGAGCAGAATGTGATGAGGATGCAGAAGATGTGTGGTGCGTATGTAACATTGACTGTTCACATATCAGCTTCAATCCGGTCTGTGCTTCAGATGGGAAATCCTATGACAATCCATGTCAAATCAAAGAAGCTTCATGTCAGAGACAGGAAAAAATTGAAGTCAAATATTTTGGGTCGATGTTCAGAAATACTACAGAAAATACAAAATCTGAAGACAGTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGAGAAGCCCATAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838183
dbEST ID: 79655885
Trimmed Sequence: GGCATGTGCTGCTCCTCCAATCTGCTTCTGTTTTCTAGTTCTTGTTATGCAGAGGACAACAATGCAAATGACAGCAATTTGAATAGTTCCAATCACAGCAGCTATTAAGACATACTGAAAACGGACTGGACCTGGAACCACGTATAACACATTGAAGTCTTTCTTTTCACAGTGAGACCCACTGTAGCCTGTATCACACCTACACCATGGCTTCAGCATGTTAACAGTGTGCTCACACCTCCCATGTACACAATAATCAACATAATGTTCAGGGCATGGAATATAAAGACCCTTTGCAGTCTCTTCTAATTTATTTGCATTCTCTGTGTAATCTGTTCTTGCAAAATGACTGTCTTCAGATTTTGTACTTTCTGTAGTATTCTCTTGACATCGACCCAAATATTTGACTTCAATTTTTTCCTGTTTCTGACATGAAGCTTCTTTGATTTGACATGGATTGTCATAGGATTTCCCATCTGAAGCACAGACCGGATTGAAGCTGATATGTGAACAGTCAATGTTACATACGCACCACACATCTTCTGCATCCTCATCACATTCTGCTCCAAACTGGCATATGTCACAAGTAAATGTCTCTTTTTTTTACTGTTTTCCCTAACCCTTCATTCCCTCCCTCCCCCTAAACCAAATCCAACCATCTGCTATCCCGGAATCCTTCACAAAAAATACAAAAATTTTCCTTCTTTTTGTTTTGACGGGGCGGGGCCTCGGGAGGGTGGGGGTTTAGTGGGGA
Full Trace Sequence: GGGGAAAATGCTATTGACCATGTAATACGACTCACTATANGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCATGTGCTGCTCCTCCAATCTGCTTCTGTTTTCTAGTTCTTGTTATGCAGAGGACAACAATGCAAATGACAGCAATTTGAATAGTTCCAATCACAGCAGCTATTAAGACATACTGAAAACGGACTGGACCTGGAACCACGTATAACACATTGAAGTCTTTCTTTTCACAGTGAGACCCACTGTAGCCTGTATCACACCTACACCATGGCTTCAGCATGTTAACAGTGTGCTCACACCTCCCATGTACACAATAATCAACATAATGTTCAGGGCATGGAATATAAAGACCCTTTGCAGTCTCTTCTAATTTATTTGCATTCTCTGTGTAATCTGTTCTTGCAAAATGACTGTCTTCAGATTTTGTACTTTCTGTAGTATTCTCTTGACATCGACCCAAATATTTGACTTCAATTTTTTCCTGTTTCTGACATGAAGCTTCTTTGATTTGACATGGATTGTCATAGGATTTCCCATCTGAAGCACAGACCGGATTGAAGCTGATATGTGAACAGTCAATGTTACATACGCACCACACATCTTCTGCATCCTCATCACATTCTGCTCCAAACTGGCATATGTCACAAGTAAATGTCTCTTTTTTTTACTGTTTTCCCTAACCCTTCATTCCCTCCCTCCCCCTAAACCAAATCCAACCATCTGCTATCCCGGAATCCTTCACAAAAAATACAAAAATTTTCCTTCTTTTTGTTTTGACGGGGCGGGGCCTCGGGAGGGTGGGGGTTTAGTGGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCATGTGCTGCTCCTCCAA