ORFeome > tmem100 ORF1 – XORFeome v1.0

tmem100 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tmem100
Gene ID: 5755010
Gene Page ID: 5755008
ORF Xenbase ID: 17301117

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081241
Original XGC clone length: 396

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ839876
dbEST ID: 79657578
Trimmed Sequence: ATGGAGCAGCCCATTAAAGAGGTTATGGGAGCTCCAAAAGGTTCGGAACCTATCCTGATGGAAAAAAACAAATAATGACTTTGTGATTACAGTTCCAAGGGTGAATGAAACCCAACTGACAGCAGCAACAGGAGGAGCAGAGCTCTCATGTTACCGCTGCACTATCCCCTTTGGAGTGGTCATACTAATAGCAGGAGTGGTAGTCACTGCCGTGGCTTACAGCTTTAATACTCATGGATCCATTATCTCTGTATTCGGGCTGGTCCTTCTGTCTTCTGGACTACTTTTGTTGTGCTTAAGTGCCCTGTGCTGGAAAATAAGGCAGAGGAAAAAGAGAACAAAAAGGAGAGAGAGCCAAACAGCCTTGGTGGCAAACCAACGGAGTTTAGTCACTTT
Full Trace Sequence: CGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGCCCATTAAAGAGGTTATGGGAGCTCCAAAAGGTTCGGAACCTATCCTGATGGAAAAAAACAAATAATGACTTTGTGATTACAGTTCCAAGGGTGAATGAAACCCAACTGACAGCAGCAACAGGAGGAGCAGAGCTCTCATGTTACCGCTGCACTATCCCCTTTGGAGTGGTCATACTAATAGCAGGAGTGGTAGTCACTGCCGTGGCTTACAGCTTTAATACTCATGGATCCATTATCTCTGTATTCGGGCTGGTCCTTCTGTCTTCTGGACTACTTTTGTTGTGCTTAAGTGCCCTGTGCTGGAAAATAAGGCAGAGGAAAAAGAGAACAAAAAGGAGAGAGAGCCAAACAGCCTTGGTGGCAAACCAACGGAGTTTAGTCACTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATTAGCTGAAAAAAAAACAAAACTAGAAAAAGTCTCAAACCCCCGAATGTTACACAAGCCCCGCAGGAAAAAAAGCCTCCCCCTCCGGCACCAGGGGTTGGGTGAAAAAAAAAAAAAAGAGAAAGGAAAAAAAACACACAAAAAACAGCGGGGGGTTGTCGGGCGGGGAAAGGGGCGCGCGGCGCCCCCCGCGCCCACAAAAACAGAACGCAGCGGGGGGGGGGGGGGGGGGGGGGGGTTGTTGTTTGTGTTGTAATTTTTTTTTCTTTTTTGCCCTAGTTATTTCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCAGCCCATTAAAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839875
dbEST ID: 79657577
Trimmed Sequence: AGTGACTAAACTCCGTTGGTTTGCCACCAAGGCTGTTTGGCTCTCTCTCCTTTTTGTTCTCTTTTTCCTCTGCCTTATTTTCCAGCACAGGGCACTTAAGCACAACAAAAGTAGTCCAGAAGACAGAAGGACCAGCCCGAATACAGAGATAATGGATCCATGAGTATTAAAGCTGTAAGCCACGGCAGTGACTACCACTCCTGCTATTAGTATGACCACTCCAAAGGGGATAGTGCAGCGGTAACATGAGAGCTCTGCTCCTCCTGTTGCTGCTGTCAGTTGGGTTTCATTCACCCTTGGAACTGTAATCACAAAGTCATTATTTGTCTTCTCCATCAGGATAGGTTCCGAACCTTTTGGAGCTCCCATAACCTCTTTAATGGGCTGCTCCATGG
Full Trace Sequence: CGTGTAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGTGACTAAACTCCGTTGGTTTGCCACCAAGGCTGTTTGGCTCTCTCTCCTTTTTGTTCTCTTTTTCCTCTGCCTTATTTTCCAGCACAGGGCACTTAAGCACAACAAAAGTAGTCCAGAAGACAGAAGGACCAGCCCGAATACAGAGATAATGGATCCATGAGTATTAAAGCTGTAAGCCACGGCAGTGACTACCACTCCTGCTATTAGTATGACCACTCCAAAGGGGATAGTGCAGCGGTAACATGAGAGCTCTGCTCCTCCTGTTGCTGCTGTCAGTTGGGTTTCATTCACCCTTGGAACTGTAATCACAAAGTCATTATTTGTCTTCTCCATCAGGATAGGTTCCGAACCTTTTGGAGCTCCCATAACCTCTTTAATGGGCTGCTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACAAAAATACAGGCCATCGTTTTACACCCGAGTTGACTGGGCAGTTTCCTGAAAGCCTCCGACACGTCTTTCAAATCCCGTGATGTTTCAAAAAAAAAATAAGTAGACGAGAGAACAACACACAACCAAAAACACAAGTACGTATGTTTCTTGTTTAAAAAACACTCCGGGCGGGGGGCCCACCCAAAAAAAGACCGTGACCCCTCGTCTCTTGTGGCTCGTGGGGGGGGGTGGGGTATGGTAGTAATGTAACTTCTTGTTATGGAAAAAAACATATCGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTGACTAAACTCCGTTGGTTTG