ORFeome > tmem11 ORF1 – XORFeome v1.0

tmem11 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem11
Gene ID: 961895
Gene Page ID: 961891
ORF Xenbase ID: 17301147

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130106
Original XGC clone length: 564

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ837602
dbEST ID: 79655304
Trimmed Sequence: ATGGCCACTTGGGGAAGGAGACGCGCTGGGCTCGGCGGTAGAGAGAGGGTGACGCTTTCAGCTGGTGAATGCTACATTGTGCATGAAATTTACAATGGAGAGAATGCCCAGGACCAGTTTGAGTATGAGCTGGAGCAGGCGCTGGAAGCCCAATATAAATACATTGTGATTGAGCCCACACGAATCGGAGATGAAACTGCTCGTTGGGTCACCGTAGGGAACTGTCTGCATAAGACTGCAGTCTTGTCAGGAACAGCCTGTCTCCTCACCCCACTGGCATTACCCGCTGAGTATTCACACTACGTATCTCTGCCAGCTGGTGTGCTCAGCTTGGCCTGCTCTACTCTCTATGGTATCTCCTGGCAATTTGATCCCTGCTGCAAATACCAAGTGGAGTATGATGCTTACAAACTATCCAGACTGCCACTACATACCCTCACCTCATCCTCACCTGTGGTGCTTGTAAGAAAGGATGACATACACAGAAAGAGACTCCACAACACAATAGCTCTTGCTGCCCTGGCATATTGCATCAAGAAGTTATATGAACTCTATTCTGTATT
Full Trace Sequence: TCGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCACTTGGGGAAGGAGACGCGCTGGGCTCGGCGGTAGAGAGAGGGTGACGCTTTCAGCTGGTGAATGCTACATTGTGCATGAAATTTACAATGGAGAGAATGCCCAGGACCAGTTTGAGTATGAGCTGGAGCAGGCGCTGGAAGCCCAATATAAATACATTGTGATTGAGCCCACACGAATCGGAGATGAAACTGCTCGTTGGGTCACCGTAGGGAACTGTCTGCATAAGACTGCAGTCTTGTCAGGAACAGCCTGTCTCCTCACCCCACTGGCATTACCCGCTGAGTATTCACACTACGTATCTCTGCCAGCTGGTGTGCTCAGCTTGGCCTGCTCTACTCTCTATGGTATCTCCTGGCAATTTGATCCCTGCTGCAAATACCAAGTGGAGTATGATGCTTACAAACTATCCAGACTGCCACTACATACCCTCACCTCATCCTCACCTGTGGTGCTTGTAAGAAAGGATGACATACACAGAAAGAGACTCCACAACACAATAGCTCTTGCTGCCCTGGCATATTGCATCAAGAAGTTATATGAACTCTATTCTGTATTGCCAACTTTCTTGTACAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAAGAGGTCACTATCAGTCAAAATAAAAATCATTATTTGCAATCCGACCTAATATCCCCTATAATGAATTCTAATTACATTGGTCATAACCTGTTTTCAAAAAAAAACAAAAAGACCGGAATCAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACTTGGGGAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837601
dbEST ID: 79655303
Trimmed Sequence: TACAGAATAGAGTTCATATAACTTCTTGATGCAATATGCCAGGGCAGCAAGAGCTATTGTGTTGTGGAGTCTCTTTCTGTGTATGTCATCCTTTCTTACAAGCACCACAGGTGAGGATGAGGTGAGGGTATGTAGTGGCAGTCTGGATAGTTTGTAAGCATCATACTCCACTTGGTATTTGCAGCAGGGATCAAATTGCCAGGAGATACCATAGAGAGTAGAGCAGGCCAAGCTGAGCACACCAGCTGGCAGAGATACATAGTGTGAATACTCAGCGGGTAATGCCAGTGGGGTGAGGAGACAGGCTGTTCCTGACAAGACTGCAGTCTTATGCAGACAGTTCCCTACGGTGACCCAACGAGCACTTTCATCTCCGATTCCTGTGGGCTGAATCACAATGGATTTATATTGGGCTTCGCGCGCCTGCTCCAGCGCATACTCAAACTGGTCCTGGGGGTTGCCTCCCTTTGTGAGTTTCTGCAGAAGGTAGCATTCTCAAGCTGAGAGCGTCACCGGCGTTCTAAACCCCAAGCCAACACATCTCCGTCTCGAATTGGAGTGGGGGCCGACTTTTTTTATATAAATTGGTCGTTAGAAAAAACCAATCCTCAGCTATTTTTTTCCAACGCAAAGGGTCAGAGTGGGGGCAGAAAGAGGAGCGTTAAATTGGAAAAAAAAAAAAAGAAAAAAAAAATAAATTCGAGGTGTCTGCTCTCCTTCTGCCTCCCGGCCGAAAAAAGAAAAAGCACCACGTCCTTTTCC
Full Trace Sequence: GGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACAGAATAGAGTTCATATAACTTCTTGATGCAATATGCCAGGGCAGCAAGAGCTATTGTGTTGTGGAGTCTCTTTCTGTGTATGTCATCCTTTCTTACAAGCACCACAGGTGAGGATGAGGTGAGGGTATGTAGTGGCAGTCTGGATAGTTTGTAAGCATCATACTCCACTTGGTATTTGCAGCAGGGATCAAATTGCCAGGAGATACCATAGAGAGTAGAGCAGGCCAAGCTGAGCACACCAGCTGGCAGAGATACATAGTGTGAATACTCAGCGGGTAATGCCAGTGGGGTGAGGAGACAGGCTGTTCCTGACAAGACTGCAGTCTTATGCAGACAGTTCCCTACGGTGACCCAACGAGCACTTTCATCTCCGATTCCTGTGGGCTGAATCACAATGGATTTATATTGGGCTTCGCGCGCCTGCTCCAGCGCATACTCAAACTGGTCCTGGGGGTTGCCTCCCTTTGTGAGTTTCTGCAGAAGGTAGCATTCTCAAGCTGAGAGCGTCACCGGCGTTCTAAACCCCAAGCCAACACATCTCCGTCTCGAATTGGAGTGGGGGCCGACTTTTTTTATATAAATTGGTCGTTAGAAAAAACCAATCCTCAGCTATTTTTTTCCAACGCAAAGGGTCAGAGTGGGGGCAGAAAGAGGAGCGTTAAATTGGAAAAAAAAAAAAAGAAAAAAAAAATAAATTCGAGGTGTCTGCTCTCCTTCTGCCTCCCGGCCGAAAAAAGAAAAAGCACCACGTCCTTTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACAGAATAGAGTTCATATAACTT