ORFeome > tmem110l ORF1 – XORFeome v1.0

tmem110l ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem110l
Gene ID: 5765405
Gene Page ID: 5765370
ORF Xenbase ID: 17301159

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC056122
Original XGC clone length: 744

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ824700
dbEST ID: 79642402
Trimmed Sequence: ATGACTGATATAATAAGATCTGCTCCCCAGGGCTGCAATAATGGGGCGCTCATGGATCACTTTGGTGTCCTTATCCAAGGAGTGTTGGCAGTGGTGGCATTCAGCACATTAATGTTAAAGCGTTGTAGGGAACCAAAAGAAGAAAGACGTCCATGGAAAATTTGGTTTTATGATACTTCCAAACAAGCTATCGGTGCTCTGTTCATTCATTTTACAAACGTCTTTCTCTCAGACTTGACTGAAAAGGACCCCTGCTCATTATACCTTATGAATTTTCTACTTGATGCTACACTTGGCATGTTGGTCATCTGGATTTGTGTGAAAATTGTGTCTGTGATCGTAGAAAGGCGACAGTCCACACTCCTAGTGTTTGGGGAATATGGGGATCCTCCACAAGCTGCGGCCTGGCTGGGGCAATGTGTACTCTATCTAGTAATAATGGTCGTGGAGAAAACCGTAATAACTCTTGTTCTGCTCTTCCCAGGATGGACAAAGCTTCAGGCGATTTTATTGAACTACATTCCAAACCCACAGCTGGAGCTTGTCCTTGTAATGCTGGTGGTACCATTTATAGTCAATGCTATATGTTTCTGGGTGGTTGACAGTTTAAAAATGAGGAAGTACAAGAAAATGAAAAGGGACAAAGTTTAGAACCACTTCAGCTCAACAGTCCTACGTATGATGATGATCACANGGTATGGCTGGGTTCTGCTCTGACATTACGCCCCTTATGAGTTGCCAACTTTTTTTGTAACAAGTGGGCATTTTAAAAAGCATGTCTTATCATATTTTCCACCAAAAGTCCCTATATCAAAAAAAAAAAATTTTCTTCACCAAA
Full Trace Sequence: TATTGATTTTTATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTGATATAATAAGATCTGCTCCCCAGGGCTGCAATAATGGGGCGCTCATGGATCACTTTGGTGTCCTTATCCAAGGAGTGTTGGCAGTGGTGGCATTCAGCACATTAATGTTAAAGCGTTGTAGGGAACCAAAAGAAGAAAGACGTCCATGGAAAATTTGGTTTTATGATACTTCCAAACAAGCTATCGGTGCTCTGTTCATTCATTTTACAAACGTCTTTCTCTCAGACTTGACTGAAAAGGACCCCTGCTCATTATACCTTATGAATTTTCTACTTGATGCTACACTTGGCATGTTGGTCATCTGGATTTGTGTGAAAATTGTGTCTGTGATCGTAGAAAGGCGACAGTCCACACTCCTAGTGTTTGGGGAATATGGGGATCCTCCACAAGCTGCGGCCTGGCTGGGGCAATGTGTACTCTATCTAGTAATAATGGTCGTGGAGAAAACCGTAATAACTCTTGTTCTGCTCTTCCCAGGATGGACAAAGCTTCAGGCGATTTTATTGAACTACATTCCAAACCCACAGCTGGAGCTTGTCCTTGTAATGCTGGTGGTACCATTTATAGTCAATGCTATATGTTTCTGGGTGGTTGACAGTTTAAAAATGAGGAAGTACAAGAAAATGAAAAGGGACAAAGTTTAGAACCACTTCAGCTCAACAGTCCTACGTATGATGATGATCACANGGTATGGCTGGGTTCTGCTCTGACATTACGCCCCTTATGAGTTGCCAACTTTTTTTGTAACAAGTGGGCATTTTAAAAAGCATGTCTTATCATATTTTCCACCAAAAGTCCCTATATCAAAAAAAAAAAATTTTCTTCACCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTGATATAATAAGATCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ830052
dbEST ID: 79647754
Trimmed Sequence: CTCATAAGAGCGGTAATGGTCAGATGCAGAACCAAGCAATACCTGTGATTCATCATCATACGTAGGACTGTTTGAGCTTGAAGTGGTTTCTAAACTTTTGTCCCTTTTCATTTTCTTGTACTTCCTCATTATTAAACTGTCAACCACCCAGAACATTATAGCATTGACTATAAATGGTACCACCAGCATTACAAGGACAAGCTCCAGCTGTGGGTTTGGAATGTAGTTCAATAAAATCGCCTGAAGCTTTGTCCATCCTGGGAAGAGCAGAACAAGAGTTATTACGGTTTTCTCCACGACCATTATTACTAGATAGAGTACACATTGCCCCAGCCAGGCCGCAGCTTGTGGAGGATCCCCATATTCCCCAAACACTAGGAGTGTGGACTGTCGCCTTTCTACGATCACAGACACAATTTTCACACAAATCCAGATGACCAACATGCCAAGTGTAGCATCAAGTAGAAAATTCATAAGGTATAATGAGCAGGGGTCCTTTTCAGTCAAGTCTGAGAGAAAGACGTTTGTAAAATGAATGAACAGAGCACCGATAGCTTGTTTGGAAGTATCATAAAACCAAATTTTCCATGGACGTCTTTCTTCTTTTGGTTCCCTACGACGCTTTAACATTAATGTGCTGAATGCCACACTGGCCACACTCCTTGGATAAGGACACCAAAGTGATCCAGGAGCGCCCCATTATTGCCGCCCTGGGGGAGCAAATCTTAATAAATAAATTCTGGGTTGCCCAACTTTTTTTTTTCC
Full Trace Sequence: CGGGTAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCATAAGAGCGGTAATGGTCAGATGCAGAACCAAGCAATACCTGTGATTCATCATCATACGTAGGACTGTTTGAGCTTGAAGTGGTTTCTAAACTTTTGTCCCTTTTCATTTTCTTGTACTTCCTCATTATTAAACTGTCAACCACCCAGAACATTATAGCATTGACTATAAATGGTACCACCAGCATTACAAGGACAAGCTCCAGCTGTGGGTTTGGAATGTAGTTCAATAAAATCGCCTGAAGCTTTGTCCATCCTGGGAAGAGCAGAACAAGAGTTATTACGGTTTTCTCCACGACCATTATTACTAGATAGAGTACACATTGCCCCAGCCAGGCCGCAGCTTGTGGAGGATCCCCATATTCCCCAAACACTAGGAGTGTGGACTGTCGCCTTTCTACGATCACAGACACAATTTTCACACAAATCCAGATGACCAACATGCCAAGTGTAGCATCAAGTAGAAAATTCATAAGGTATAATGAGCAGGGGTCCTTTTCAGTCAAGTCTGAGAGAAAGACGTTTGTAAAATGAATGAACAGAGCACCGATAGCTTGTTTGGAAGTATCATAAAACCAAATTTTCCATGGACGTCTTTCTTCTTTTGGTTCCCTACGACGCTTTAACATTAATGTGCTGAATGCCACACTGGCCACACTCCTTGGATAAGGACACCAAAGTGATCCAGGAGCGCCCCATTATTGCCGCCCTGGGGGAGCAAATCTTAATAAATAAATTCTGGGTTGCCCAACTTTTTTTTTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCATAAGAGCGGTAATGGT